ID: 1154430244

View in Genome Browser
Species Human (GRCh38)
Location 18:14303104-14303126
Sequence CAGTACAGAAGGAGAGTATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154430238_1154430244 1 Left 1154430238 18:14303080-14303102 CCTCATGGTAAACCTCTACTGGG No data
Right 1154430244 18:14303104-14303126 CAGTACAGAAGGAGAGTATAGGG No data
1154430232_1154430244 30 Left 1154430232 18:14303051-14303073 CCAGCCAGAAGCTTTTCCAAGAG No data
Right 1154430244 18:14303104-14303126 CAGTACAGAAGGAGAGTATAGGG No data
1154430236_1154430244 14 Left 1154430236 18:14303067-14303089 CCAAGAGGCAGAGCCTCATGGTA No data
Right 1154430244 18:14303104-14303126 CAGTACAGAAGGAGAGTATAGGG No data
1154430234_1154430244 26 Left 1154430234 18:14303055-14303077 CCAGAAGCTTTTCCAAGAGGCAG No data
Right 1154430244 18:14303104-14303126 CAGTACAGAAGGAGAGTATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154430244 Original CRISPR CAGTACAGAAGGAGAGTATA GGG Intergenic
No off target data available for this crispr