ID: 1154430258

View in Genome Browser
Species Human (GRCh38)
Location 18:14303195-14303217
Sequence CTGTAGCTTTTCAACACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154430258_1154430266 16 Left 1154430258 18:14303195-14303217 CCCTCAGTGTTGAAAAGCTACAG No data
Right 1154430266 18:14303234-14303256 TAGCCAATGAGGGCAGCTGTGGG No data
1154430258_1154430262 6 Left 1154430258 18:14303195-14303217 CCCTCAGTGTTGAAAAGCTACAG No data
Right 1154430262 18:14303224-14303246 AACACCAGCCTAGCCAATGAGGG No data
1154430258_1154430267 17 Left 1154430258 18:14303195-14303217 CCCTCAGTGTTGAAAAGCTACAG No data
Right 1154430267 18:14303235-14303257 AGCCAATGAGGGCAGCTGTGGGG No data
1154430258_1154430261 5 Left 1154430258 18:14303195-14303217 CCCTCAGTGTTGAAAAGCTACAG No data
Right 1154430261 18:14303223-14303245 CAACACCAGCCTAGCCAATGAGG 0: 7
1: 45
2: 1227
3: 10741
4: 69028
1154430258_1154430268 18 Left 1154430258 18:14303195-14303217 CCCTCAGTGTTGAAAAGCTACAG No data
Right 1154430268 18:14303236-14303258 GCCAATGAGGGCAGCTGTGGGGG No data
1154430258_1154430265 15 Left 1154430258 18:14303195-14303217 CCCTCAGTGTTGAAAAGCTACAG No data
Right 1154430265 18:14303233-14303255 CTAGCCAATGAGGGCAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154430258 Original CRISPR CTGTAGCTTTTCAACACTGA GGG (reversed) Intergenic
No off target data available for this crispr