ID: 1154430791

View in Genome Browser
Species Human (GRCh38)
Location 18:14306988-14307010
Sequence CTACAATTCCACATGAATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154430791_1154430800 7 Left 1154430791 18:14306988-14307010 CCAATATTCATGTGGAATTGTAG No data
Right 1154430800 18:14307018-14307040 TGTTAAAGGTGGGACCTGGCGGG No data
1154430791_1154430796 -4 Left 1154430791 18:14306988-14307010 CCAATATTCATGTGGAATTGTAG No data
Right 1154430796 18:14307007-14307029 GTAGTGGGGAATGTTAAAGGTGG No data
1154430791_1154430797 -3 Left 1154430791 18:14306988-14307010 CCAATATTCATGTGGAATTGTAG No data
Right 1154430797 18:14307008-14307030 TAGTGGGGAATGTTAAAGGTGGG No data
1154430791_1154430795 -7 Left 1154430791 18:14306988-14307010 CCAATATTCATGTGGAATTGTAG No data
Right 1154430795 18:14307004-14307026 ATTGTAGTGGGGAATGTTAAAGG No data
1154430791_1154430803 24 Left 1154430791 18:14306988-14307010 CCAATATTCATGTGGAATTGTAG No data
Right 1154430803 18:14307035-14307057 GGCGGGAGGTGATTTAATCATGG No data
1154430791_1154430798 3 Left 1154430791 18:14306988-14307010 CCAATATTCATGTGGAATTGTAG No data
Right 1154430798 18:14307014-14307036 GGAATGTTAAAGGTGGGACCTGG No data
1154430791_1154430801 10 Left 1154430791 18:14306988-14307010 CCAATATTCATGTGGAATTGTAG No data
Right 1154430801 18:14307021-14307043 TAAAGGTGGGACCTGGCGGGAGG No data
1154430791_1154430799 6 Left 1154430791 18:14306988-14307010 CCAATATTCATGTGGAATTGTAG No data
Right 1154430799 18:14307017-14307039 ATGTTAAAGGTGGGACCTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154430791 Original CRISPR CTACAATTCCACATGAATAT TGG (reversed) Intergenic
No off target data available for this crispr