ID: 1154431170

View in Genome Browser
Species Human (GRCh38)
Location 18:14309718-14309740
Sequence AAAAATGCACAGGTACAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154431166_1154431170 2 Left 1154431166 18:14309693-14309715 CCAGCTCCAGCTCCAGTCATGAT No data
Right 1154431170 18:14309718-14309740 AAAAATGCACAGGTACAGCTTGG No data
1154431167_1154431170 -4 Left 1154431167 18:14309699-14309721 CCAGCTCCAGTCATGATTGAAAA No data
Right 1154431170 18:14309718-14309740 AAAAATGCACAGGTACAGCTTGG No data
1154431164_1154431170 17 Left 1154431164 18:14309678-14309700 CCTGCAGCTCCAGCTCCAGCTCC 0: 22
1: 26
2: 68
3: 356
4: 1762
Right 1154431170 18:14309718-14309740 AAAAATGCACAGGTACAGCTTGG No data
1154431163_1154431170 18 Left 1154431163 18:14309677-14309699 CCCTGCAGCTCCAGCTCCAGCTC 0: 19
1: 19
2: 47
3: 227
4: 1074
Right 1154431170 18:14309718-14309740 AAAAATGCACAGGTACAGCTTGG No data
1154431165_1154431170 8 Left 1154431165 18:14309687-14309709 CCAGCTCCAGCTCCAGCTCCAGT No data
Right 1154431170 18:14309718-14309740 AAAAATGCACAGGTACAGCTTGG No data
1154431162_1154431170 25 Left 1154431162 18:14309670-14309692 CCTGCATCCCTGCAGCTCCAGCT 0: 25
1: 47
2: 177
3: 665
4: 1726
Right 1154431170 18:14309718-14309740 AAAAATGCACAGGTACAGCTTGG No data
1154431168_1154431170 -10 Left 1154431168 18:14309705-14309727 CCAGTCATGATTGAAAAATGCAC No data
Right 1154431170 18:14309718-14309740 AAAAATGCACAGGTACAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154431170 Original CRISPR AAAAATGCACAGGTACAGCT TGG Intergenic
No off target data available for this crispr