ID: 1154439350

View in Genome Browser
Species Human (GRCh38)
Location 18:14373827-14373849
Sequence AGGAATAGGGAGAAAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154439344_1154439350 18 Left 1154439344 18:14373786-14373808 CCTGACAGCAAAGACAATGCAAA No data
Right 1154439350 18:14373827-14373849 AGGAATAGGGAGAAAGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154439350 Original CRISPR AGGAATAGGGAGAAAGAGGC AGG Intergenic
No off target data available for this crispr