ID: 1154441444

View in Genome Browser
Species Human (GRCh38)
Location 18:14393182-14393204
Sequence CCCTGTGACCCGCTCCTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 1, 2: 3, 3: 36, 4: 208}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154441439_1154441444 -6 Left 1154441439 18:14393165-14393187 CCAGGCTGAGCCTCTACCCCTGT No data
Right 1154441444 18:14393182-14393204 CCCTGTGACCCGCTCCTGGCCGG 0: 1
1: 1
2: 3
3: 36
4: 208
1154441430_1154441444 28 Left 1154441430 18:14393131-14393153 CCCCTGGCTGGTGGAGGAGCCTT No data
Right 1154441444 18:14393182-14393204 CCCTGTGACCCGCTCCTGGCCGG 0: 1
1: 1
2: 3
3: 36
4: 208
1154441432_1154441444 26 Left 1154441432 18:14393133-14393155 CCTGGCTGGTGGAGGAGCCTTCT No data
Right 1154441444 18:14393182-14393204 CCCTGTGACCCGCTCCTGGCCGG 0: 1
1: 1
2: 3
3: 36
4: 208
1154441438_1154441444 -5 Left 1154441438 18:14393164-14393186 CCCAGGCTGAGCCTCTACCCCTG No data
Right 1154441444 18:14393182-14393204 CCCTGTGACCCGCTCCTGGCCGG 0: 1
1: 1
2: 3
3: 36
4: 208
1154441431_1154441444 27 Left 1154441431 18:14393132-14393154 CCCTGGCTGGTGGAGGAGCCTTC No data
Right 1154441444 18:14393182-14393204 CCCTGTGACCCGCTCCTGGCCGG 0: 1
1: 1
2: 3
3: 36
4: 208
1154441437_1154441444 9 Left 1154441437 18:14393150-14393172 CCTTCTTGGGGCAGCCCAGGCTG No data
Right 1154441444 18:14393182-14393204 CCCTGTGACCCGCTCCTGGCCGG 0: 1
1: 1
2: 3
3: 36
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154441444 Original CRISPR CCCTGTGACCCGCTCCTGGC CGG Intergenic
900490173 1:2944089-2944111 CCCTGTGTCCTGCTCCAGGCTGG + Intergenic
900600040 1:3498981-3499003 ACCTGTGCCCCTCTCCAGGCAGG - Intronic
901145350 1:7061239-7061261 CACTGAGACCCGGTCCTGCCCGG + Intronic
901237557 1:7675630-7675652 ACCTGAGACCCGCTCCTGCTGGG - Intronic
901603263 1:10439004-10439026 CCCTGTGTCCTGGTCCTTGCAGG + Intronic
901772553 1:11537703-11537725 CCCTGTGACCTGTTCCAGGAGGG - Intergenic
904608938 1:31714773-31714795 CTCCTTGACCCGCTCCTGGGTGG + Intergenic
905629517 1:39510937-39510959 CCCTGAGCCCTGCACCTGGCTGG - Intronic
905668243 1:39775253-39775275 CCCTGAGCCCCGCAGCTGGCTGG + Intronic
906231684 1:44169873-44169895 AGCTGTGAGCCGATCCTGGCAGG + Intergenic
908195377 1:61742400-61742422 CCCGGTGCCCCGCCCCGGGCGGG + Intergenic
908791113 1:67782460-67782482 CCTTGGGACTGGCTCCTGGCTGG + Intronic
911231221 1:95363455-95363477 CCATGTGGCCCACACCTGGCAGG - Intergenic
912488574 1:110048457-110048479 CCCTGAGCCCAGCTCCTGGGTGG + Intronic
915719189 1:157971607-157971629 CCCTGTGACAGGCTTCTGCCTGG + Intergenic
921163717 1:212491063-212491085 GCCTCTGCCCGGCTCCTGGCTGG + Intergenic
922856292 1:228777791-228777813 CCCTGTGACTCTCTCCTGTGTGG - Intergenic
922916087 1:229258908-229258930 CCCTGAGTCCCGCCCCTGGGTGG + Intergenic
924065032 1:240212313-240212335 CCCTGTGACCCGTAGTTGGCTGG + Intronic
1062857011 10:784502-784524 CCCTGTCACCAGGTGCTGGCTGG - Intergenic
1062917061 10:1248544-1248566 AGCTGTGAGCTGCTCCTGGCCGG + Intronic
1063121081 10:3106154-3106176 CCCTGTGAACCACTCCTCCCCGG - Intronic
1063380668 10:5583579-5583601 CCCTCTGCCCCTCTCCAGGCCGG - Intergenic
1065821448 10:29529366-29529388 CACGGTCACCCGCTCCTGGCCGG - Intronic
1068746203 10:60533350-60533372 CCCTCTGTCCAGCTCCTGGGAGG - Intronic
1069325876 10:67230992-67231014 GACTGTGTCCCGCACCTGGCTGG + Intronic
1069823753 10:71242851-71242873 CCCAGTGCCCTGCTGCTGGCAGG - Intronic
1069832983 10:71292328-71292350 CCCTGTCTCCCACCCCTGGCTGG + Intronic
1070768606 10:79069971-79069993 CCCTGGGCTCCCCTCCTGGCCGG - Intronic
1071678255 10:87677575-87677597 CCCTGTAACCAGCTCCGTGCAGG + Intronic
1072050777 10:91700991-91701013 CCCTGGGACCCACACCTGGGAGG + Intergenic
1072417844 10:95263822-95263844 TCCTCTGAGCCGCTCCTGGGAGG - Intronic
1072613668 10:97035481-97035503 CCATCTGATCCGCCCCTGGCTGG + Intronic
1072632720 10:97157689-97157711 CCCTGTGCTCCTCCCCTGGCAGG - Intronic
1072667100 10:97401492-97401514 CCCTGAAACCTGGTCCTGGCTGG - Intronic
1072951008 10:99846765-99846787 CCCTGTGCCTAGCCCCTGGCTGG + Intronic
1073493847 10:103873567-103873589 CCCTGTGACAGTCTCATGGCAGG - Intergenic
1075095725 10:119469349-119469371 CCCGGTGAAGCGCTCCTGCCAGG - Intergenic
1076424977 10:130361390-130361412 CCCAGGGACCCCCTCCAGGCTGG - Intergenic
1076675311 10:132144467-132144489 CCCTCTGGCCGGCACCTGGCAGG + Intronic
1077124017 11:924670-924692 TCCTGTGCCCTCCTCCTGGCCGG + Intergenic
1077243298 11:1523252-1523274 GGCTGTGAACCGCTCCTGGCCGG + Intergenic
1077324904 11:1959483-1959505 TCCCGTGACCCGCTCCTGCCTGG + Intronic
1077974330 11:7232061-7232083 CCCTGTAACCTGCTCCTGATAGG - Intergenic
1081715312 11:45245980-45246002 CCTTGTCACCCACACCTGGCTGG - Intronic
1081863231 11:46346043-46346065 CCCTGGCACCAGCTGCTGGCTGG + Intronic
1082879548 11:58024663-58024685 CCGTGTGACCCTCTCCTCTCTGG + Intronic
1083702679 11:64490118-64490140 CCCTGAGACCCTCCTCTGGCTGG - Intergenic
1083803260 11:65058622-65058644 CCCTTTGACCCCCAGCTGGCAGG + Intergenic
1084169187 11:67392266-67392288 CCGGGTTACCCGCTCCCGGCTGG - Intronic
1084380038 11:68805909-68805931 CCCTGTGACCCCCTGCAGGCGGG - Intronic
1084967254 11:72751214-72751236 TCCTGTGTCCCATTCCTGGCTGG - Intronic
1085740679 11:79075909-79075931 GCTTGTGACCCGCTCCTCTCTGG - Intronic
1089171871 11:116517688-116517710 CCCTGTGGCTGGCTCCTGGCCGG - Intergenic
1089189741 11:116645090-116645112 CCCTCTGATGGGCTCCTGGCTGG - Intergenic
1089772988 11:120816555-120816577 CTCAGTGAGCCGCTCCTGCCAGG + Intronic
1091319690 11:134640765-134640787 CCCTGTGACCCTCTCCTCCTGGG - Intergenic
1202807886 11_KI270721v1_random:14662-14684 TCCCGTGACCCGCTCCTGCCTGG + Intergenic
1095160136 12:38905823-38905845 CTCCGTGATCCCCTCCTGGCTGG + Intronic
1096715010 12:53486138-53486160 CCCTGTCACCCCCTCCTTACTGG - Exonic
1102600396 12:114025364-114025386 ACCTGTGACTTGCTCCTAGCTGG + Intergenic
1104687161 12:130793966-130793988 TCCTGTGCCCCGGGCCTGGCTGG - Intronic
1104705815 12:130946643-130946665 CCCTGTGCCCTGCGGCTGGCAGG + Intergenic
1105247400 13:18665940-18665962 CCCTGTGACCTGCTCCTGGCCGG - Intergenic
1105541333 13:21319761-21319783 GCCTGTGGCCCGCACCTGGCAGG - Intergenic
1105704346 13:22960244-22960266 CCCTCTGACCCAGGCCTGGCGGG + Intergenic
1105704986 13:22963045-22963067 TCCTGTGCCCAGCTCCTGGTTGG - Intergenic
1105753197 13:23440885-23440907 CCCTGTGGTGCGCTCCGGGCAGG - Intergenic
1105857297 13:24385296-24385318 CCCTCTGACCCAGGCCTGGCGGG + Intergenic
1106235025 13:27854089-27854111 CTCTGTGCCCAGCTTCTGGCTGG + Intergenic
1106569064 13:30910698-30910720 AGCTGTGACCTGCTCCTGGATGG + Intronic
1108261966 13:48667398-48667420 CCCTGCAAGCCACTCCTGGCAGG - Intronic
1108482117 13:50884073-50884095 CACTGTGCCCAGCTCCTCGCAGG - Intergenic
1108483938 13:50905991-50906013 CCTTGAGATCCGGTCCTGGCTGG - Intergenic
1112614258 13:100987229-100987251 CCCTGTGACCTGCTTCTGAATGG + Intergenic
1112736785 13:102430160-102430182 CCCTGTAAGCTGCACCTGGCAGG - Intergenic
1113518387 13:110920341-110920363 GCCACTGACCGGCTCCTGGCTGG + Intergenic
1113518558 13:110921570-110921592 CCCACTGACCCGCTTCTGCCTGG + Intergenic
1113654742 13:112061112-112061134 CCCCGGGAGCCGCGCCTGGCCGG - Intergenic
1113655935 13:112067795-112067817 CCGTTTGACCCGGTCCTGGTTGG - Exonic
1113926462 13:113944361-113944383 CCCTGGCACCTGGTCCTGGCAGG - Intergenic
1119079116 14:71675320-71675342 CCCTGTGTCTCCCTCCAGGCTGG - Intronic
1119438420 14:74612458-74612480 CCCAGTGTCCCGGTCGTGGCAGG - Intergenic
1119659054 14:76437694-76437716 CCCTCAGACCCAATCCTGGCTGG + Intronic
1120881250 14:89416870-89416892 CCCCGTGCCCCGCTCCGGCCAGG - Intronic
1121244366 14:92451482-92451504 CCCTGTGCCCAGCTCCAAGCAGG + Intronic
1122167526 14:99839927-99839949 CCCTGCGTACCACTCCTGGCTGG - Intronic
1123063634 14:105605625-105605647 CCCTGTGACCCGCTTGGAGCTGG + Intergenic
1124291441 15:28456451-28456473 CCCTGTCACCTGCTCCAGGCAGG + Intergenic
1125115085 15:36080964-36080986 CCCTGTTGGCCACTCCTGGCAGG + Intergenic
1126713244 15:51484209-51484231 CCCTGTGGGCTGCTTCTGGCAGG + Intronic
1126879785 15:53082192-53082214 CCCAGTCATCCTCTCCTGGCAGG - Intergenic
1127452023 15:59125705-59125727 CCCCGTGACAGGCCCCTGGCAGG + Intergenic
1129220455 15:74129007-74129029 CACTGTGACCCGTCCCTGCCGGG - Exonic
1129744353 15:78007810-78007832 CTCTGTGCCCAGCTCCTGTCCGG - Intronic
1130147517 15:81285611-81285633 CCCAGGGGCCCACTCCTGGCTGG - Intronic
1131152084 15:90053650-90053672 CCCCATGACCAGCTCCAGGCAGG - Intronic
1132653426 16:1031621-1031643 CCCTGAGTCCAGCACCTGGCCGG - Intergenic
1132751170 16:1458405-1458427 GCCTGTCACCCGCGCCAGGCTGG - Intronic
1132826795 16:1909234-1909256 CCCAGTGATCCCCTCCTGGCAGG + Intergenic
1133130441 16:3673380-3673402 CGCTGGGACCAGCTCCTGTCTGG + Intronic
1136707341 16:32201220-32201242 CCCTGTCACCTGCTCCAGGCAGG - Intergenic
1136760572 16:32728197-32728219 CCCTGTCACCTGCTCCAGGCAGG + Intergenic
1136807531 16:33142189-33142211 CCCTGTCACCTGCTCCAGGCAGG - Intergenic
1137384600 16:48030005-48030027 CCCTGTGACCAGCAGCTGGAAGG + Intergenic
1137446755 16:48536616-48536638 CCCTTTCACCCCCTCCTGCCTGG - Intergenic
1138658094 16:58502093-58502115 CCCTGAGACTGGCACCTGGCAGG + Intronic
1142116135 16:88357084-88357106 CCCTCTGACCCGGGCCGGGCTGG + Intergenic
1142349981 16:89575514-89575536 CCCAGGGACCGGCTCCGGGCTGG - Intergenic
1203062725 16_KI270728v1_random:988512-988534 CCCTGTCACCTGCTCCAGGCAGG + Intergenic
1144621761 17:16822744-16822766 CCCTGTGAATCACGCCTGGCGGG - Intergenic
1145147566 17:20494407-20494429 CCCTGTGAATCACGCCTGGCGGG - Intergenic
1145191110 17:20842649-20842671 CCCTGTCACCTGCTACAGGCAGG - Intronic
1147573744 17:41587086-41587108 CCCTGTGAATCACGCCTGGCGGG - Intergenic
1147646627 17:42038167-42038189 CCCTCTGTCCCTCTCTTGGCTGG - Intronic
1148202451 17:45758275-45758297 CCCAGAGCCCTGCTCCTGGCTGG - Intergenic
1148479180 17:47949051-47949073 CCCTGTGGCCCCCTGCAGGCAGG + Intergenic
1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG + Intronic
1151697455 17:75724797-75724819 CCCTGCAGCCCCCTCCTGGCAGG + Intronic
1152072807 17:78142369-78142391 ACCAGTGACCAGCTCCTGGCTGG + Exonic
1152315762 17:79579480-79579502 CCCTGGGACCTGCTCGGGGCAGG + Intergenic
1152429822 17:80242544-80242566 CCCTGTGCCTCCCTCCAGGCAGG + Intronic
1152643386 17:81458237-81458259 CCCTGGGGCCCGCTCCAGGGTGG - Exonic
1154441444 18:14393182-14393204 CCCTGTGACCCGCTCCTGGCCGG + Intergenic
1155486188 18:26345351-26345373 CCCTGTGGGCTGCTCCTTGCAGG + Intronic
1157452197 18:47797180-47797202 CCCTGTGGCCTGCTTCTGGCTGG + Intergenic
1158686286 18:59617541-59617563 CACTGTGACTGGCTCTTGGCCGG - Intronic
1160265687 18:77339481-77339503 CCCTGCCACCCACTCCTGGGTGG - Intergenic
1160922044 19:1525548-1525570 GCCTGTGCCCCGCTGCAGGCGGG + Intronic
1161531492 19:4792570-4792592 CCCTGCGACCTGCTCCTGGCCGG - Exonic
1161802650 19:6424581-6424603 CCCGGTCCCCCGCGCCTGGCGGG + Exonic
1162498258 19:11035467-11035489 CCTTGTGCCTCCCTCCTGGCAGG - Intronic
1162789847 19:13057185-13057207 CCCACTGACCCGCTACTGGCTGG - Intronic
1163128757 19:15258986-15259008 CCCTGGGCCCCACTCCTGGGAGG - Intronic
1164069173 19:21750676-21750698 CCCCGCGACCCGCCCCGGGCAGG - Intronic
1168037286 19:53730121-53730143 CTCTGTGACCCTGCCCTGGCTGG + Intergenic
1168115873 19:54221164-54221186 CCCTGTGAGCCGCTCCTACGGGG - Exonic
1168125174 19:54278893-54278915 CCCTGTGAGCCGCTCCTACGGGG - Exonic
1168133798 19:54337481-54337503 CCCTGTGAGCCGCTCCTACGGGG - Exonic
1168172081 19:54595832-54595854 CCCTGTGAGCCGCTCCTACGGGG + Exonic
1168176800 19:54632657-54632679 CCCTGTGAGCCGCTCCTACGGGG + Exonic
925194659 2:1913387-1913409 TCCTGTGACCCCCTCCAGCCAGG - Intronic
925274438 2:2638677-2638699 CCCTGTGCCCGCCTCCTGCCTGG - Intergenic
925751237 2:7091731-7091753 ACCTGTGGCCAGCTCCAGGCAGG - Intergenic
925882345 2:8363334-8363356 CCCTGAGCCCTGCTCCCGGCTGG + Intergenic
926384235 2:12320298-12320320 CCCTGTGACTGGCACCTGGCAGG + Intergenic
927867352 2:26598668-26598690 CCCTGGGACACTCTCCTGGCAGG - Intronic
928378510 2:30798638-30798660 GCCTGCGGCCCTCTCCTGGCTGG + Intronic
929484142 2:42339750-42339772 GCCTGTGACCCGCTCCTGTCAGG + Intronic
929536911 2:42789627-42789649 CTTTGTGACCCTCTCTTGGCTGG - Intronic
932469730 2:71945907-71945929 CTCTGTGGCCCTCTCCTGCCAGG - Intergenic
932738431 2:74272631-74272653 CCAGGTGCCCCGCTCCTGACTGG + Intronic
934655044 2:96113001-96113023 GACTGTGACCCTCTGCTGGCCGG - Exonic
934951774 2:98580551-98580573 CCCTGCCAGCCTCTCCTGGCAGG + Intronic
935727263 2:106034473-106034495 CTCTGTCACCCACTCCAGGCTGG - Intergenic
935946194 2:108288824-108288846 CCCTGTGACCTGGCCCTGGGAGG - Exonic
936389055 2:112055397-112055419 CCCTGCCTCCCGGTCCTGGCCGG + Exonic
938408430 2:131045414-131045436 CCCTGTGACCTGCTGCTTGCTGG - Exonic
941116747 2:161480494-161480516 TCCTGTGCGCTGCTCCTGGCAGG + Intronic
941420716 2:165280424-165280446 CTCTGTGTCACTCTCCTGGCAGG + Intronic
942318109 2:174712973-174712995 GCCTGTGACAGGCTCCTGGCTGG - Intergenic
944016419 2:195044747-195044769 CCCCTTGACCCACTCCTGCCAGG + Intergenic
946043738 2:216803960-216803982 GCCTGTGACCCGCTGCTCTCAGG + Intergenic
946146723 2:217736689-217736711 CCATGTGTCCAGCACCTGGCCGG - Intronic
946712173 2:222517544-222517566 CCCTGTGACCTGATCCTTCCTGG + Intronic
948714830 2:239854280-239854302 CCCTGAGCCTCGCTCCTGGGTGG + Intergenic
948806605 2:240455903-240455925 CCCTGAGGCCCGCTGCAGGCTGG - Intronic
1169046577 20:2538156-2538178 TCCTGTGACCCGCTGCTGTCTGG + Intronic
1169744346 20:8928357-8928379 CCCTCTGACTCTCTACTGGCTGG + Intronic
1171459512 20:25290947-25290969 CCCTGGGCCCCTCTGCTGGCAGG + Intronic
1171459542 20:25291040-25291062 CCCTGGGCCCCTCTGCTGGCAGG + Intronic
1173405185 20:42758329-42758351 ACCTGTGCCCCTCTCCTGACAGG - Intronic
1176085248 20:63292912-63292934 CCCTGTGAGCCCCTCCTTGCAGG + Intergenic
1176454615 21:6897993-6898015 CCCTATGAGCTGCTCCTGGCCGG - Intergenic
1176832788 21:13763041-13763063 CCCTATGAGCTGCTCCTGGCCGG - Intergenic
1178518179 21:33266267-33266289 GCCTGTGCCCCGCGCCTCGCGGG + Intronic
1179295002 21:40053810-40053832 CCCAGTGACCAGCTCTTGGAAGG + Intronic
1180185242 21:46135944-46135966 CCCTGTCACCCCCTGCCGGCCGG + Intergenic
1181027905 22:20136147-20136169 CCCTCTGAGCCCCTCCTGGCTGG - Intronic
1181334115 22:22116338-22116360 CCCTGTCACCTGCTACAGGCAGG + Intergenic
1182141798 22:27966147-27966169 CCCTGTAATTCCCTCCTGGCTGG - Intergenic
950107743 3:10398916-10398938 CCCTATGACTCACTCCAGGCTGG + Intronic
954693178 3:52406639-52406661 GCCTGTGGCCTGCTCCTGGGTGG - Intronic
956502107 3:69898116-69898138 CTCTGTGCCCCTCTCCTGTCTGG - Intronic
960375840 3:116900410-116900432 GCCTGAGTCCCTCTCCTGGCTGG - Intronic
961447328 3:126987014-126987036 GCCTCTCACCCACTCCTGGCTGG - Intergenic
961717011 3:128864641-128864663 CTCTGTGCCCCGGGCCTGGCTGG - Intergenic
962840148 3:139225680-139225702 CCCTGAGGCCCTCTCCAGGCAGG - Intronic
969603107 4:8188695-8188717 CCCCGGGACCCACACCTGGCTGG + Intronic
969692445 4:8711067-8711089 CACTCTGCCCTGCTCCTGGCAGG - Intergenic
974463775 4:62226178-62226200 CTCTGTGACCGCCTCCTGTCTGG + Intergenic
975988547 4:80231396-80231418 TCCTGTGACCCAATCCTGTCTGG - Intergenic
984839567 4:184055717-184055739 GCCTGTGAGCCTCTCCTGGCTGG + Intergenic
985478148 5:91421-91443 CCCTGTGAGGCCCTCCTGGACGG + Intergenic
985976864 5:3426082-3426104 TCCTCTGTCCCGCTCCTGCCAGG + Intergenic
986243339 5:5981326-5981348 CCCTGTGACCTGTGCCTGGCGGG - Intergenic
988968071 5:36439856-36439878 CCATGTGAACAGCTCCTGACAGG + Intergenic
997892591 5:137688246-137688268 GCCTGTGATCCTCTCCTGGGTGG - Intronic
1001554985 5:172631075-172631097 CCCTGTCACCCACTCCTGGCTGG + Intergenic
1002181563 5:177433543-177433565 ACCTGTGGCCCGCACCTGGCAGG - Exonic
1002461414 5:179375813-179375835 CCCTTTCCCCCTCTCCTGGCTGG - Intergenic
1002527429 5:179822568-179822590 GCCTGTGACCTGCTCCTGAGGGG - Intronic
1003107361 6:3226998-3227020 CCCGCCCACCCGCTCCTGGCGGG - Intronic
1005914669 6:30341971-30341993 CCCTGAGACTGGCTACTGGCGGG + Exonic
1006063290 6:31441876-31441898 CCCTGTTCCCCGCACCTGGACGG + Intergenic
1007257845 6:40541157-40541179 GCCTGGGACCCGCTGATGGCTGG - Intronic
1007398277 6:41589608-41589630 CTCTGTGACCCGCTCCAGGGAGG - Intronic
1013667874 6:112366699-112366721 CCCGGCGTCCTGCTCCTGGCTGG + Intergenic
1013889138 6:115005115-115005137 CCCTGTGGCCTCCTGCTGGCAGG - Intergenic
1019634864 7:2070129-2070151 CCCTGAGGCCCGCTACTGCCAGG - Intronic
1019713218 7:2526771-2526793 CCCTGGGCCCCGCCCCAGGCTGG - Intronic
1020092230 7:5348258-5348280 CCCTGTCACCTGCTCATGGGTGG - Intronic
1022496098 7:30854046-30854068 CCCTGTGATCTGCTGCTGTCTGG - Intronic
1026585954 7:71656381-71656403 CCCTGTGCCCCATTCCTGCCCGG - Intronic
1026896023 7:74010521-74010543 AGCTGTGACCCCCTCCTCGCTGG + Intergenic
1029318548 7:99736478-99736500 CCCTGTGACCCATTCCTGATGGG + Intergenic
1029604062 7:101588022-101588044 GCCTGTGACCTGCTCTGGGCTGG + Intergenic
1030496233 7:110304402-110304424 TCCTGTGATGGGCTCCTGGCAGG - Intergenic
1032894994 7:136240684-136240706 CCCTCTGGCCCCCTCCTGGATGG - Intergenic
1033552274 7:142458259-142458281 TCCTGTGCCCTGCACCTGGCAGG - Intergenic
1033556815 7:142495313-142495335 TCCTGTGCCCTGCACCTGGCAGG - Intergenic
1034872791 7:154698784-154698806 GCCTGAGACTAGCTCCTGGCTGG - Intronic
1034951015 7:155297431-155297453 CCTGGTGTCCCGCGCCTGGCCGG - Intergenic
1034987615 7:155526751-155526773 CTCTGTCACCCACTGCTGGCTGG + Intronic
1036411996 8:8510849-8510871 CACAGTGCCCAGCTCCTGGCAGG - Intergenic
1036428410 8:8667374-8667396 TTCTGTGACCCTATCCTGGCTGG + Intergenic
1039563241 8:38529686-38529708 CCCTGTGCCTAGCTCTTGGCTGG + Intergenic
1039920225 8:41888504-41888526 CTCCGTGTCCGGCTCCTGGCAGG + Intronic
1044868963 8:96599850-96599872 CACTGTGCCCGGCTCCTGGCCGG - Intronic
1048292436 8:133191220-133191242 CCCTCTGAGCCCCTCCAGGCAGG - Intronic
1048306665 8:133289423-133289445 CCATGTGTCCCTCTCCTCGCTGG - Intronic
1049508855 8:143017989-143018011 CCCTGCTTCCCGCTCCAGGCTGG - Intronic
1052916767 9:33929078-33929100 TCCTTTGGCCCGCTCCTGGTGGG - Intronic
1053046691 9:34926285-34926307 CTCTGTGAGCCACTTCTGGCAGG - Intergenic
1053276706 9:36788600-36788622 CACTGTGACCCCCTCCTGCCAGG - Intergenic
1053288471 9:36864789-36864811 CCCTCGGAGCCCCTCCTGGCTGG + Intronic
1056665761 9:88579442-88579464 CTCTGTGACCAGCTGCTGCCAGG - Intronic
1057915679 9:99053459-99053481 CCCTGTGAGCCTCCCCTGGAAGG + Intronic
1059746689 9:117207660-117207682 CCCTTTGAGCAGCTCCTGGCAGG + Intronic
1061201570 9:129141212-129141234 CCTGGTGACCCACTCCTGGCAGG - Intronic
1061544614 9:131297246-131297268 CCCTGGGACCTGCTCCTAGCAGG + Intronic
1062136231 9:134929818-134929840 ACCTTGGACCAGCTCCTGGCAGG + Intergenic
1185593074 X:1291477-1291499 CCCAGTGCCCTGCTCCTGGCTGG + Intronic
1185721922 X:2389200-2389222 CCAGGTGACCCCTTCCTGGCTGG - Intronic
1189350586 X:40272850-40272872 CCCTGTTTCCCGCACCTGGTGGG + Intergenic
1196849165 X:119921272-119921294 CCCTGTGAACCTCTCTTGCCTGG + Intergenic
1200117452 X:153775572-153775594 CCCTGTGGCCGGCTCCCCGCAGG + Exonic
1200239530 X:154486478-154486500 CTCTCTCGCCCGCTCCTGGCAGG - Intronic
1200281106 X:154777863-154777885 CCCTGCCCCCCGCTCCTGCCAGG - Intergenic