ID: 1154446071

View in Genome Browser
Species Human (GRCh38)
Location 18:14436910-14436932
Sequence GGTGGTGGTTGTTCAGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154446071_1154446077 4 Left 1154446071 18:14436910-14436932 CCCTTTGCTGAACAACCACCACC No data
Right 1154446077 18:14436937-14436959 TTCTAGGACCCCCACACCCTTGG No data
1154446071_1154446080 13 Left 1154446071 18:14436910-14436932 CCCTTTGCTGAACAACCACCACC No data
Right 1154446080 18:14436946-14436968 CCCCACACCCTTGGTTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154446071 Original CRISPR GGTGGTGGTTGTTCAGCAAA GGG (reversed) Intergenic
No off target data available for this crispr