ID: 1154446080

View in Genome Browser
Species Human (GRCh38)
Location 18:14436946-14436968
Sequence CCCCACACCCTTGGTTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154446071_1154446080 13 Left 1154446071 18:14436910-14436932 CCCTTTGCTGAACAACCACCACC No data
Right 1154446080 18:14436946-14436968 CCCCACACCCTTGGTTCTGCAGG No data
1154446072_1154446080 12 Left 1154446072 18:14436911-14436933 CCTTTGCTGAACAACCACCACCA No data
Right 1154446080 18:14436946-14436968 CCCCACACCCTTGGTTCTGCAGG No data
1154446074_1154446080 -2 Left 1154446074 18:14436925-14436947 CCACCACCAACATTCTAGGACCC No data
Right 1154446080 18:14436946-14436968 CCCCACACCCTTGGTTCTGCAGG No data
1154446075_1154446080 -5 Left 1154446075 18:14436928-14436950 CCACCAACATTCTAGGACCCCCA No data
Right 1154446080 18:14436946-14436968 CCCCACACCCTTGGTTCTGCAGG No data
1154446076_1154446080 -8 Left 1154446076 18:14436931-14436953 CCAACATTCTAGGACCCCCACAC No data
Right 1154446080 18:14436946-14436968 CCCCACACCCTTGGTTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154446080 Original CRISPR CCCCACACCCTTGGTTCTGC AGG Intergenic
No off target data available for this crispr