ID: 1154449035

View in Genome Browser
Species Human (GRCh38)
Location 18:14459823-14459845
Sequence TCTGCCGCTCAGCCCCATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154449030_1154449035 29 Left 1154449030 18:14459771-14459793 CCAGATACTGCGGTGGCGCCTAA No data
Right 1154449035 18:14459823-14459845 TCTGCCGCTCAGCCCCATCCTGG No data
1154449031_1154449035 11 Left 1154449031 18:14459789-14459811 CCTAATTCAGACTGTAGCTGCAG No data
Right 1154449035 18:14459823-14459845 TCTGCCGCTCAGCCCCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154449035 Original CRISPR TCTGCCGCTCAGCCCCATCC TGG Intergenic
No off target data available for this crispr