ID: 1154449599

View in Genome Browser
Species Human (GRCh38)
Location 18:14463233-14463255
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154449599_1154449603 2 Left 1154449599 18:14463233-14463255 CCTGATATTCTCTGTGATGGAAG No data
Right 1154449603 18:14463258-14463280 ACAGCCCTCCTCAGAGACCCGGG No data
1154449599_1154449602 1 Left 1154449599 18:14463233-14463255 CCTGATATTCTCTGTGATGGAAG No data
Right 1154449602 18:14463257-14463279 GACAGCCCTCCTCAGAGACCCGG No data
1154449599_1154449610 19 Left 1154449599 18:14463233-14463255 CCTGATATTCTCTGTGATGGAAG No data
Right 1154449610 18:14463275-14463297 CCCGGGGGAGCCCAGAACCATGG No data
1154449599_1154449605 4 Left 1154449599 18:14463233-14463255 CCTGATATTCTCTGTGATGGAAG No data
Right 1154449605 18:14463260-14463282 AGCCCTCCTCAGAGACCCGGGGG No data
1154449599_1154449604 3 Left 1154449599 18:14463233-14463255 CCTGATATTCTCTGTGATGGAAG No data
Right 1154449604 18:14463259-14463281 CAGCCCTCCTCAGAGACCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154449599 Original CRISPR CTTCCATCACAGAGAATATC AGG (reversed) Intergenic