ID: 1154449602

View in Genome Browser
Species Human (GRCh38)
Location 18:14463257-14463279
Sequence GACAGCCCTCCTCAGAGACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154449599_1154449602 1 Left 1154449599 18:14463233-14463255 CCTGATATTCTCTGTGATGGAAG No data
Right 1154449602 18:14463257-14463279 GACAGCCCTCCTCAGAGACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154449602 Original CRISPR GACAGCCCTCCTCAGAGACC CGG Intergenic
No off target data available for this crispr