ID: 1154449605

View in Genome Browser
Species Human (GRCh38)
Location 18:14463260-14463282
Sequence AGCCCTCCTCAGAGACCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154449599_1154449605 4 Left 1154449599 18:14463233-14463255 CCTGATATTCTCTGTGATGGAAG No data
Right 1154449605 18:14463260-14463282 AGCCCTCCTCAGAGACCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154449605 Original CRISPR AGCCCTCCTCAGAGACCCGG GGG Intergenic
No off target data available for this crispr