ID: 1154449606

View in Genome Browser
Species Human (GRCh38)
Location 18:14463262-14463284
Sequence CTCCCCCGGGTCTCTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154449606_1154449610 -10 Left 1154449606 18:14463262-14463284 CCCTCCTCAGAGACCCGGGGGAG No data
Right 1154449610 18:14463275-14463297 CCCGGGGGAGCCCAGAACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154449606 Original CRISPR CTCCCCCGGGTCTCTGAGGA GGG (reversed) Intergenic