ID: 1154449610 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:14463275-14463297 |
Sequence | CCCGGGGGAGCCCAGAACCA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1154449606_1154449610 | -10 | Left | 1154449606 | 18:14463262-14463284 | CCCTCCTCAGAGACCCGGGGGAG | No data | ||
Right | 1154449610 | 18:14463275-14463297 | CCCGGGGGAGCCCAGAACCATGG | No data | ||||
1154449599_1154449610 | 19 | Left | 1154449599 | 18:14463233-14463255 | CCTGATATTCTCTGTGATGGAAG | No data | ||
Right | 1154449610 | 18:14463275-14463297 | CCCGGGGGAGCCCAGAACCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1154449610 | Original CRISPR | CCCGGGGGAGCCCAGAACCA TGG | Intergenic | ||