ID: 1154461421

View in Genome Browser
Species Human (GRCh38)
Location 18:14592085-14592107
Sequence TGGGATGTTCTGTGAATATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154461421_1154461424 19 Left 1154461421 18:14592085-14592107 CCAGATATTCACAGAACATCCCA No data
Right 1154461424 18:14592127-14592149 GCATTCTCCCCATCAGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154461421 Original CRISPR TGGGATGTTCTGTGAATATC TGG (reversed) Intergenic
No off target data available for this crispr