ID: 1154463243

View in Genome Browser
Species Human (GRCh38)
Location 18:14617640-14617662
Sequence GCAGTTGGTCCAACGTTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154463234_1154463243 23 Left 1154463234 18:14617594-14617616 CCCCGGCATCAGCTGGGAGTCTT No data
Right 1154463243 18:14617640-14617662 GCAGTTGGTCCAACGTTCTGTGG No data
1154463240_1154463243 -4 Left 1154463240 18:14617621-14617643 CCCATAGAGCTTTTATGCTGCAG No data
Right 1154463243 18:14617640-14617662 GCAGTTGGTCCAACGTTCTGTGG No data
1154463236_1154463243 21 Left 1154463236 18:14617596-14617618 CCGGCATCAGCTGGGAGTCTTGC No data
Right 1154463243 18:14617640-14617662 GCAGTTGGTCCAACGTTCTGTGG No data
1154463237_1154463243 -1 Left 1154463237 18:14617618-14617640 CCCCCCATAGAGCTTTTATGCTG No data
Right 1154463243 18:14617640-14617662 GCAGTTGGTCCAACGTTCTGTGG No data
1154463238_1154463243 -2 Left 1154463238 18:14617619-14617641 CCCCCATAGAGCTTTTATGCTGC No data
Right 1154463243 18:14617640-14617662 GCAGTTGGTCCAACGTTCTGTGG No data
1154463239_1154463243 -3 Left 1154463239 18:14617620-14617642 CCCCATAGAGCTTTTATGCTGCA No data
Right 1154463243 18:14617640-14617662 GCAGTTGGTCCAACGTTCTGTGG No data
1154463235_1154463243 22 Left 1154463235 18:14617595-14617617 CCCGGCATCAGCTGGGAGTCTTG No data
Right 1154463243 18:14617640-14617662 GCAGTTGGTCCAACGTTCTGTGG No data
1154463241_1154463243 -5 Left 1154463241 18:14617622-14617644 CCATAGAGCTTTTATGCTGCAGT No data
Right 1154463243 18:14617640-14617662 GCAGTTGGTCCAACGTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154463243 Original CRISPR GCAGTTGGTCCAACGTTCTG TGG Intergenic
No off target data available for this crispr