ID: 1154466004

View in Genome Browser
Species Human (GRCh38)
Location 18:14643071-14643093
Sequence TGCCCCCAACCAGCCCTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154466004_1154466014 19 Left 1154466004 18:14643071-14643093 CCAGCAAGGGCTGGTTGGGGGCA No data
Right 1154466014 18:14643113-14643135 TGGAGGCAGTGGGGCAGTTTGGG No data
1154466004_1154466011 9 Left 1154466004 18:14643071-14643093 CCAGCAAGGGCTGGTTGGGGGCA No data
Right 1154466011 18:14643103-14643125 GCTGCACTGCTGGAGGCAGTGGG No data
1154466004_1154466007 2 Left 1154466004 18:14643071-14643093 CCAGCAAGGGCTGGTTGGGGGCA No data
Right 1154466007 18:14643096-14643118 ATCCCTGGCTGCACTGCTGGAGG No data
1154466004_1154466010 8 Left 1154466004 18:14643071-14643093 CCAGCAAGGGCTGGTTGGGGGCA No data
Right 1154466010 18:14643102-14643124 GGCTGCACTGCTGGAGGCAGTGG No data
1154466004_1154466012 10 Left 1154466004 18:14643071-14643093 CCAGCAAGGGCTGGTTGGGGGCA No data
Right 1154466012 18:14643104-14643126 CTGCACTGCTGGAGGCAGTGGGG No data
1154466004_1154466006 -1 Left 1154466004 18:14643071-14643093 CCAGCAAGGGCTGGTTGGGGGCA No data
Right 1154466006 18:14643093-14643115 ACTATCCCTGGCTGCACTGCTGG No data
1154466004_1154466013 18 Left 1154466004 18:14643071-14643093 CCAGCAAGGGCTGGTTGGGGGCA No data
Right 1154466013 18:14643112-14643134 CTGGAGGCAGTGGGGCAGTTTGG No data
1154466004_1154466015 20 Left 1154466004 18:14643071-14643093 CCAGCAAGGGCTGGTTGGGGGCA No data
Right 1154466015 18:14643114-14643136 GGAGGCAGTGGGGCAGTTTGGGG No data
1154466004_1154466016 21 Left 1154466004 18:14643071-14643093 CCAGCAAGGGCTGGTTGGGGGCA No data
Right 1154466016 18:14643115-14643137 GAGGCAGTGGGGCAGTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154466004 Original CRISPR TGCCCCCAACCAGCCCTTGC TGG (reversed) Intergenic