ID: 1154466114

View in Genome Browser
Species Human (GRCh38)
Location 18:14643585-14643607
Sequence TCCAGCTGGCCAGGAACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154466114_1154466122 24 Left 1154466114 18:14643585-14643607 CCAGCAGTTCCTGGCCAGCTGGA No data
Right 1154466122 18:14643632-14643654 AAGGCAGTCACACCCACCCCAGG No data
1154466114_1154466120 5 Left 1154466114 18:14643585-14643607 CCAGCAGTTCCTGGCCAGCTGGA No data
Right 1154466120 18:14643613-14643635 CCAGAGGCCAGTTTCAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154466114 Original CRISPR TCCAGCTGGCCAGGAACTGC TGG (reversed) Intergenic
No off target data available for this crispr