ID: 1154469097

View in Genome Browser
Species Human (GRCh38)
Location 18:14681058-14681080
Sequence CTACATAAACAGAGTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154469097_1154469101 24 Left 1154469097 18:14681058-14681080 CCATCCTCACTCTGTTTATGTAG No data
Right 1154469101 18:14681105-14681127 TTCCCTAAGTGCAGTGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154469097 Original CRISPR CTACATAAACAGAGTGAGGA TGG (reversed) Intergenic
No off target data available for this crispr