ID: 1154470367

View in Genome Browser
Species Human (GRCh38)
Location 18:14694146-14694168
Sequence GAATTGGTGTGGATCCCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154470367_1154470376 21 Left 1154470367 18:14694146-14694168 CCCGCTGGGATCCACACCAATTC No data
Right 1154470376 18:14694190-14694212 TCACTCCTCTTTGTTCTCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154470367 Original CRISPR GAATTGGTGTGGATCCCAGC GGG (reversed) Intergenic
No off target data available for this crispr