ID: 1154470367 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:14694146-14694168 |
Sequence | GAATTGGTGTGGATCCCAGC GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1154470367_1154470376 | 21 | Left | 1154470367 | 18:14694146-14694168 | CCCGCTGGGATCCACACCAATTC | No data | ||
Right | 1154470376 | 18:14694190-14694212 | TCACTCCTCTTTGTTCTCCGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1154470367 | Original CRISPR | GAATTGGTGTGGATCCCAGC GGG (reversed) | Intergenic | ||
No off target data available for this crispr |