ID: 1154489426

View in Genome Browser
Species Human (GRCh38)
Location 18:14908345-14908367
Sequence TCCCGCACAGCTGTCATTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154489426_1154489427 -6 Left 1154489426 18:14908345-14908367 CCACAAATGACAGCTGTGCGGGA No data
Right 1154489427 18:14908362-14908384 GCGGGACTCTTTCTGTCTGCAGG No data
1154489426_1154489430 24 Left 1154489426 18:14908345-14908367 CCACAAATGACAGCTGTGCGGGA No data
Right 1154489430 18:14908392-14908414 ATCAGCCAACTCAACATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154489426 Original CRISPR TCCCGCACAGCTGTCATTTG TGG (reversed) Intergenic
No off target data available for this crispr