ID: 1154489427

View in Genome Browser
Species Human (GRCh38)
Location 18:14908362-14908384
Sequence GCGGGACTCTTTCTGTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154489423_1154489427 -3 Left 1154489423 18:14908342-14908364 CCTCCACAAATGACAGCTGTGCG No data
Right 1154489427 18:14908362-14908384 GCGGGACTCTTTCTGTCTGCAGG No data
1154489420_1154489427 16 Left 1154489420 18:14908323-14908345 CCTCTACAGATGCAACTCCCCTC No data
Right 1154489427 18:14908362-14908384 GCGGGACTCTTTCTGTCTGCAGG No data
1154489426_1154489427 -6 Left 1154489426 18:14908345-14908367 CCACAAATGACAGCTGTGCGGGA No data
Right 1154489427 18:14908362-14908384 GCGGGACTCTTTCTGTCTGCAGG No data
1154489422_1154489427 -2 Left 1154489422 18:14908341-14908363 CCCTCCACAAATGACAGCTGTGC No data
Right 1154489427 18:14908362-14908384 GCGGGACTCTTTCTGTCTGCAGG No data
1154489421_1154489427 -1 Left 1154489421 18:14908340-14908362 CCCCTCCACAAATGACAGCTGTG No data
Right 1154489427 18:14908362-14908384 GCGGGACTCTTTCTGTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154489427 Original CRISPR GCGGGACTCTTTCTGTCTGC AGG Intergenic
No off target data available for this crispr