ID: 1154489430

View in Genome Browser
Species Human (GRCh38)
Location 18:14908392-14908414
Sequence ATCAGCCAACTCAACATATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154489423_1154489430 27 Left 1154489423 18:14908342-14908364 CCTCCACAAATGACAGCTGTGCG No data
Right 1154489430 18:14908392-14908414 ATCAGCCAACTCAACATATTTGG No data
1154489421_1154489430 29 Left 1154489421 18:14908340-14908362 CCCCTCCACAAATGACAGCTGTG No data
Right 1154489430 18:14908392-14908414 ATCAGCCAACTCAACATATTTGG No data
1154489422_1154489430 28 Left 1154489422 18:14908341-14908363 CCCTCCACAAATGACAGCTGTGC No data
Right 1154489430 18:14908392-14908414 ATCAGCCAACTCAACATATTTGG No data
1154489426_1154489430 24 Left 1154489426 18:14908345-14908367 CCACAAATGACAGCTGTGCGGGA No data
Right 1154489430 18:14908392-14908414 ATCAGCCAACTCAACATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154489430 Original CRISPR ATCAGCCAACTCAACATATT TGG Intergenic
No off target data available for this crispr