ID: 1154491759

View in Genome Browser
Species Human (GRCh38)
Location 18:14927697-14927719
Sequence CCCATAAACTCCAAAGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154491755_1154491759 25 Left 1154491755 18:14927649-14927671 CCTCCTGTGCTTTAAGATATTAA No data
Right 1154491759 18:14927697-14927719 CCCATAAACTCCAAAGTTCCTGG No data
1154491756_1154491759 22 Left 1154491756 18:14927652-14927674 CCTGTGCTTTAAGATATTAAATA No data
Right 1154491759 18:14927697-14927719 CCCATAAACTCCAAAGTTCCTGG No data
1154491754_1154491759 28 Left 1154491754 18:14927646-14927668 CCTCCTCCTGTGCTTTAAGATAT No data
Right 1154491759 18:14927697-14927719 CCCATAAACTCCAAAGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154491759 Original CRISPR CCCATAAACTCCAAAGTTCC TGG Intergenic
No off target data available for this crispr