ID: 1154494672

View in Genome Browser
Species Human (GRCh38)
Location 18:14946762-14946784
Sequence AGGGCTGATACCATTTTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154494672_1154494684 30 Left 1154494672 18:14946762-14946784 CCTAGAAAAATGGTATCAGCCCT No data
Right 1154494684 18:14946815-14946837 TCCCTCATGTGCGATCACAGTGG No data
1154494672_1154494678 0 Left 1154494672 18:14946762-14946784 CCTAGAAAAATGGTATCAGCCCT No data
Right 1154494678 18:14946785-14946807 GGGTCAAATCCTGCCCCTCTGGG No data
1154494672_1154494677 -1 Left 1154494672 18:14946762-14946784 CCTAGAAAAATGGTATCAGCCCT No data
Right 1154494677 18:14946784-14946806 TGGGTCAAATCCTGCCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154494672 Original CRISPR AGGGCTGATACCATTTTTCT AGG (reversed) Intergenic
No off target data available for this crispr