ID: 1154498034

View in Genome Browser
Species Human (GRCh38)
Location 18:14976891-14976913
Sequence AATCATACGCCCCTGCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154498030_1154498034 -10 Left 1154498030 18:14976878-14976900 CCTTCCTCACTTTAATCATACGC No data
Right 1154498034 18:14976891-14976913 AATCATACGCCCCTGCTGGGAGG No data
1154498027_1154498034 22 Left 1154498027 18:14976846-14976868 CCATGACTCTTCTGTGGGCCGCG No data
Right 1154498034 18:14976891-14976913 AATCATACGCCCCTGCTGGGAGG No data
1154498029_1154498034 -9 Left 1154498029 18:14976877-14976899 CCCTTCCTCACTTTAATCATACG No data
Right 1154498034 18:14976891-14976913 AATCATACGCCCCTGCTGGGAGG No data
1154498028_1154498034 4 Left 1154498028 18:14976864-14976886 CCGCGCACTCATGCCCTTCCTCA No data
Right 1154498034 18:14976891-14976913 AATCATACGCCCCTGCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154498034 Original CRISPR AATCATACGCCCCTGCTGGG AGG Intergenic
No off target data available for this crispr