ID: 1154500132

View in Genome Browser
Species Human (GRCh38)
Location 18:14991967-14991989
Sequence CTGCGGCAGGCAGTGGCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154500128_1154500132 -1 Left 1154500128 18:14991945-14991967 CCTTTGAGGCTGTGAGGCAGGGC No data
Right 1154500132 18:14991967-14991989 CTGCGGCAGGCAGTGGCCAGTGG No data
1154500121_1154500132 16 Left 1154500121 18:14991928-14991950 CCCGGAGGGCAGGCCTGCCTTTG No data
Right 1154500132 18:14991967-14991989 CTGCGGCAGGCAGTGGCCAGTGG No data
1154500125_1154500132 3 Left 1154500125 18:14991941-14991963 CCTGCCTTTGAGGCTGTGAGGCA No data
Right 1154500132 18:14991967-14991989 CTGCGGCAGGCAGTGGCCAGTGG No data
1154500122_1154500132 15 Left 1154500122 18:14991929-14991951 CCGGAGGGCAGGCCTGCCTTTGA No data
Right 1154500132 18:14991967-14991989 CTGCGGCAGGCAGTGGCCAGTGG No data
1154500118_1154500132 30 Left 1154500118 18:14991914-14991936 CCTGGGTAGAGGTGCCCGGAGGG No data
Right 1154500132 18:14991967-14991989 CTGCGGCAGGCAGTGGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154500132 Original CRISPR CTGCGGCAGGCAGTGGCCAG TGG Intergenic
No off target data available for this crispr