ID: 1154500762

View in Genome Browser
Species Human (GRCh38)
Location 18:14996739-14996761
Sequence GGTGGGACAAACCCCATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154500756_1154500762 26 Left 1154500756 18:14996690-14996712 CCTTAGTTTTCCTTTGGGGAACC No data
Right 1154500762 18:14996739-14996761 GGTGGGACAAACCCCATTGCTGG No data
1154500757_1154500762 16 Left 1154500757 18:14996700-14996722 CCTTTGGGGAACCATATCACTCT No data
Right 1154500762 18:14996739-14996761 GGTGGGACAAACCCCATTGCTGG No data
1154500758_1154500762 5 Left 1154500758 18:14996711-14996733 CCATATCACTCTACGCTTGAGTG No data
Right 1154500762 18:14996739-14996761 GGTGGGACAAACCCCATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154500762 Original CRISPR GGTGGGACAAACCCCATTGC TGG Intergenic