ID: 1154504725

View in Genome Browser
Species Human (GRCh38)
Location 18:15024488-15024510
Sequence ATGTTGTAGCTTACTGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154504723_1154504725 13 Left 1154504723 18:15024452-15024474 CCTTGATTTAAGCGCAGGATTTC No data
Right 1154504725 18:15024488-15024510 ATGTTGTAGCTTACTGAACAAGG No data
1154504721_1154504725 22 Left 1154504721 18:15024443-15024465 CCTTTGAGACCTTGATTTAAGCG No data
Right 1154504725 18:15024488-15024510 ATGTTGTAGCTTACTGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154504725 Original CRISPR ATGTTGTAGCTTACTGAACA AGG Intergenic
No off target data available for this crispr