ID: 1154521880

View in Genome Browser
Species Human (GRCh38)
Location 18:15238853-15238875
Sequence CAGAACCTGTAGCAGTGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154521880_1154521884 19 Left 1154521880 18:15238853-15238875 CCAGATCACTGCTACAGGTTCTG No data
Right 1154521884 18:15238895-15238917 GGATTCTAGAACACTGCTACTGG No data
1154521880_1154521881 -2 Left 1154521880 18:15238853-15238875 CCAGATCACTGCTACAGGTTCTG No data
Right 1154521881 18:15238874-15238896 TGAATGTTTGTCCCTCACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154521880 Original CRISPR CAGAACCTGTAGCAGTGATC TGG (reversed) Intergenic
No off target data available for this crispr