ID: 1154521880 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:15238853-15238875 |
| Sequence | CAGAACCTGTAGCAGTGATC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1154521880_1154521884 | 19 | Left | 1154521880 | 18:15238853-15238875 | CCAGATCACTGCTACAGGTTCTG | No data | ||
| Right | 1154521884 | 18:15238895-15238917 | GGATTCTAGAACACTGCTACTGG | No data | ||||
| 1154521880_1154521881 | -2 | Left | 1154521880 | 18:15238853-15238875 | CCAGATCACTGCTACAGGTTCTG | No data | ||
| Right | 1154521881 | 18:15238874-15238896 | TGAATGTTTGTCCCTCACAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1154521880 | Original CRISPR | CAGAACCTGTAGCAGTGATC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||