ID: 1154527847

View in Genome Browser
Species Human (GRCh38)
Location 18:15311520-15311542
Sequence ACCTAGGAGAAACTCCCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154527847_1154527850 -3 Left 1154527847 18:15311520-15311542 CCTGAAGGGAGTTTCTCCTAGGT No data
Right 1154527850 18:15311540-15311562 GGTCTGGTCAGACCTTTGTATGG 0: 40
1: 82
2: 96
3: 77
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154527847 Original CRISPR ACCTAGGAGAAACTCCCTTC AGG (reversed) Intergenic
No off target data available for this crispr