ID: 1154529741

View in Genome Browser
Species Human (GRCh38)
Location 18:15331308-15331330
Sequence GGCGCGAGCCAAGGAAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154529741_1154529748 3 Left 1154529741 18:15331308-15331330 CCTGCTCTTCCTTGGCTCGCGCC No data
Right 1154529748 18:15331334-15331356 AGCGCTGGTTTGCAGGCTCTGGG No data
1154529741_1154529747 2 Left 1154529741 18:15331308-15331330 CCTGCTCTTCCTTGGCTCGCGCC No data
Right 1154529747 18:15331333-15331355 GAGCGCTGGTTTGCAGGCTCTGG No data
1154529741_1154529750 27 Left 1154529741 18:15331308-15331330 CCTGCTCTTCCTTGGCTCGCGCC No data
Right 1154529750 18:15331358-15331380 ACTGTGCAGTCACCAGGATACGG No data
1154529741_1154529744 -4 Left 1154529741 18:15331308-15331330 CCTGCTCTTCCTTGGCTCGCGCC No data
Right 1154529744 18:15331327-15331349 CGCCCTGAGCGCTGGTTTGCAGG No data
1154529741_1154529749 21 Left 1154529741 18:15331308-15331330 CCTGCTCTTCCTTGGCTCGCGCC No data
Right 1154529749 18:15331352-15331374 CTGGGCACTGTGCAGTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154529741 Original CRISPR GGCGCGAGCCAAGGAAGAGC AGG (reversed) Intergenic
No off target data available for this crispr