ID: 1154933177

View in Genome Browser
Species Human (GRCh38)
Location 18:21022157-21022179
Sequence CTATAGCCTACATTTTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 249}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154933177_1154933179 11 Left 1154933177 18:21022157-21022179 CCACAAAAAAATGTAGGCTATAG 0: 1
1: 0
2: 2
3: 22
4: 249
Right 1154933179 18:21022191-21022213 TTCAAAGAATGCTCTAGGAATGG 0: 1
1: 0
2: 0
3: 28
4: 1690
1154933177_1154933178 6 Left 1154933177 18:21022157-21022179 CCACAAAAAAATGTAGGCTATAG 0: 1
1: 0
2: 2
3: 22
4: 249
Right 1154933178 18:21022186-21022208 AAAAGTTCAAAGAATGCTCTAGG 0: 1
1: 0
2: 2
3: 30
4: 390
1154933177_1154933180 28 Left 1154933177 18:21022157-21022179 CCACAAAAAAATGTAGGCTATAG 0: 1
1: 0
2: 2
3: 22
4: 249
Right 1154933180 18:21022208-21022230 GAATGGACAGATAATTACTCTGG 0: 1
1: 0
2: 0
3: 12
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154933177 Original CRISPR CTATAGCCTACATTTTTTTG TGG (reversed) Intronic
903073532 1:20743203-20743225 CTAGATTCTACATTTATTTGTGG - Exonic
904893802 1:33799132-33799154 CTATAGCCTATTTTTATATGTGG + Intronic
908565907 1:65355929-65355951 CTAGAGGCAGCATTTTTTTGTGG + Intronic
911138680 1:94472405-94472427 CTATAAACAACATTTTTGTGTGG + Intronic
913966356 1:143380617-143380639 CTGTAAGCTGCATTTTTTTGAGG + Intergenic
914060729 1:144206224-144206246 CTGTAAGCTGCATTTTTTTGAGG + Intergenic
914118421 1:144760145-144760167 CTGTAAGCTGCATTTTTTTGAGG - Intergenic
916295272 1:163212305-163212327 CTCCAGCCTACATGTTTTGGGGG - Intronic
917261902 1:173178727-173178749 TTAGAGCATACATATTTTTGGGG - Intergenic
917934056 1:179847195-179847217 CTATAGCCGACCATTTTTTTAGG + Intronic
918672321 1:187234148-187234170 CTAATGTCTACATTTTTTTCTGG - Intergenic
919617132 1:199821707-199821729 CAATAGCCTGGATGTTTTTGGGG - Intergenic
923327522 1:232893817-232893839 CTATATCTTACATTTTAATGGGG - Intergenic
924227325 1:241932871-241932893 CTTTAGCCTACATCTATTTGAGG - Intergenic
924250358 1:242126971-242126993 CCTTAGCCTACTTTTTTATGGGG - Intronic
924358370 1:243208805-243208827 CTGTAGCCTACACTTTAGTGGGG - Intronic
924513524 1:244747900-244747922 GCACAGCCTAAATTTTTTTGTGG + Intergenic
924889692 1:248261271-248261293 CCTTTGCCTACATTTTTATGGGG - Intergenic
1065452826 10:25876684-25876706 CTTTAGCCTCCTTTCTTTTGAGG + Intergenic
1065814358 10:29470793-29470815 CTAGAGCTAAGATTTTTTTGGGG + Intronic
1067823673 10:49553203-49553225 CTCTAGCCTCCAAATTTTTGGGG - Intergenic
1067940806 10:50654080-50654102 CCAGATCCTCCATTTTTTTGTGG + Intergenic
1068863069 10:61867237-61867259 CTATCTCCTACATTTTCTTTTGG + Intergenic
1069251313 10:66270542-66270564 ATATAGCCTACATTCTTTTGTGG + Intronic
1071216995 10:83417058-83417080 CTGTAGTTTTCATTTTTTTGTGG + Intergenic
1072510065 10:96113168-96113190 CTATCTCCTACAGTTTTTTTAGG - Intergenic
1077780775 11:5327121-5327143 CTATTTACTACATTTTCTTGAGG - Intronic
1078214662 11:9301367-9301389 TTATAGTATACATTTTTTTTAGG - Intronic
1079584158 11:22104925-22104947 CTATAGATTACATTTTATTAAGG - Intergenic
1080219215 11:29880767-29880789 GTATAGCCTACACTTCTGTGAGG - Intergenic
1080430969 11:32199451-32199473 CTTTAGCCCACATATATTTGGGG - Intergenic
1082712443 11:56569642-56569664 CTATTTCCTGCAGTTTTTTGGGG + Intergenic
1082900402 11:58243585-58243607 ATATAACCTTCATTGTTTTGAGG + Intergenic
1083810558 11:65103275-65103297 CCATTGCCTGCATTTTGTTGGGG - Intronic
1086171216 11:83838142-83838164 GTATACCTTTCATTTTTTTGAGG - Intronic
1086248164 11:84780376-84780398 ATATGGCCTATATTTTTTTGAGG - Intronic
1087232309 11:95679960-95679982 AAATAGGATACATTTTTTTGTGG - Intergenic
1088022117 11:105132341-105132363 CTTTAACATACATTTTTCTGAGG - Intergenic
1088218468 11:107540244-107540266 CTATACAATAGATTTTTTTGTGG - Intronic
1091560807 12:1611535-1611557 CAATAGCATGCATTTATTTGTGG + Intronic
1091658354 12:2362422-2362444 CTGAATCCTACATGTTTTTGTGG + Intronic
1092617833 12:10231711-10231733 CTATAGGCTCCTTTTTATTGAGG + Intergenic
1092682002 12:10993738-10993760 CTAGAGCCTACATTTGCTAGAGG - Intronic
1093092981 12:14942141-14942163 CTAATGCCTAGATTCTTTTGTGG - Exonic
1094262341 12:28515286-28515308 CTAAAGCTTTCATTTTGTTGAGG + Intronic
1095258038 12:40063790-40063812 TTATAGTCAACATTTTTCTGGGG - Intronic
1095285577 12:40406602-40406624 TTATGGCCTGCAATTTTTTGGGG + Intronic
1097227934 12:57489906-57489928 CTCTAGCCGACATTGTTTTGTGG + Exonic
1097504337 12:60445752-60445774 CTCTAGACTACAAATTTTTGGGG + Intergenic
1098422941 12:70323080-70323102 CTATAGCTTCCCTTTTTTTTTGG - Intronic
1099035691 12:77584850-77584872 TTTTACCCTACATTTTTTTGAGG - Intergenic
1100081866 12:90862292-90862314 GTATCACCTAGATTTTTTTGTGG + Intergenic
1102602563 12:114043193-114043215 CTATTGCCTCCTTTTTGTTGGGG + Intergenic
1108393639 13:49972452-49972474 CTAGAGCCTTTATTTTTTTTGGG + Intergenic
1111284640 13:86072984-86073006 TTATATCCTACATTTTATTTTGG + Intergenic
1111344875 13:86938660-86938682 ATAAAGCCTATAATTTTTTGAGG + Intergenic
1111818913 13:93190348-93190370 CTATAGCTTAGATTTTCTTAGGG - Intergenic
1112136825 13:96588374-96588396 CTATGGCCTATATTGTGTTGAGG + Intronic
1116321116 14:43464338-43464360 TTATGGCCTTCATTATTTTGAGG + Intergenic
1116669716 14:47825313-47825335 CTATAGCAAACATATTTTAGGGG + Intergenic
1117357644 14:54940914-54940936 GTATAGCCTGGATTTTTTTGAGG - Exonic
1117710496 14:58524115-58524137 CTCTGGCCTAAATTTATTTGAGG - Intronic
1118080479 14:62353199-62353221 CTAAAGACTCCATTTTTTTTCGG - Intergenic
1119829437 14:77688189-77688211 CTGTAGACAACATCTTTTTGAGG + Intronic
1120599630 14:86485727-86485749 CCATTCCCTACATTTTTTTGTGG + Intergenic
1121065553 14:90960779-90960801 CTCAAGCTTACAATTTTTTGTGG - Intronic
1121458670 14:94056133-94056155 CTATAGTCTTCCCTTTTTTGGGG - Intronic
1124817737 15:33013009-33013031 CTATAGCCTCCTTGGTTTTGTGG - Intronic
1125225745 15:37393963-37393985 CTACAGCTTATATTCTTTTGGGG + Intergenic
1126293885 15:47115157-47115179 CTATAGGTTCCATTTTTATGAGG + Intergenic
1129638205 15:77345180-77345202 ATATGGCCTACATTATGTTGAGG + Intronic
1129873456 15:78956640-78956662 ATATAGCCTCCATGTTTTGGAGG - Intergenic
1130628828 15:85544317-85544339 CTATATCATATATTTTTTTCTGG + Intronic
1133463561 16:6008216-6008238 CTACACACTACCTTTTTTTGGGG - Intergenic
1136415571 16:30101287-30101309 AGATAGCCTCAATTTTTTTGGGG - Intergenic
1138329515 16:56202380-56202402 CTGTAGCCCACATTTCTTTTGGG - Intronic
1138755009 16:59473645-59473667 ATATAGCCTTCATTATGTTGAGG - Intergenic
1139213171 16:65101051-65101073 ATATAGCCTACACATATTTGAGG - Intronic
1140534461 16:75696697-75696719 CATTATCCTACATTTTTTTTAGG - Intronic
1142830162 17:2542872-2542894 CGATAGACTAGATTTTTTTCTGG - Intergenic
1143192136 17:5047702-5047724 CTAGAACCTACATCTGTTTGAGG - Intronic
1146423682 17:32714719-32714741 GTATTGCCTAGATTTTCTTGTGG - Intronic
1147115401 17:38295493-38295515 CTATATCGTACATTCTTATGTGG - Intergenic
1148414277 17:47494103-47494125 CTATATCGTACATTCTTCTGTGG + Intergenic
1150513187 17:65777764-65777786 ATATATCCTATATTTTTTTCTGG + Intronic
1150907995 17:69359122-69359144 GTGAAGGCTACATTTTTTTGCGG - Intergenic
1152708056 17:81855591-81855613 GTAGAACCTACATTTGTTTGGGG - Intronic
1152998149 18:427732-427754 CTATTGACTACATTTATTTGGGG + Intronic
1153077369 18:1179974-1179996 ATATAGCCTTCATTATATTGAGG - Intergenic
1154296386 18:13153545-13153567 ATATAGCCTATATTATTTTGAGG + Intergenic
1154933177 18:21022157-21022179 CTATAGCCTACATTTTTTTGTGG - Intronic
1155619472 18:27760602-27760624 CTATAGTCTACATTTTTGTATGG - Intergenic
1157643689 18:49244721-49244743 CTATAGACTACCTTGTTTTTGGG - Intronic
1157753988 18:50202142-50202164 TTTTATCCTACATTTTTTTGTGG - Intergenic
1157782873 18:50455809-50455831 CTAATGCCTACATTTGTATGAGG - Intergenic
1158011359 18:52731961-52731983 CTAGAGCCTAAATCTTTTTACGG + Intronic
1158030457 18:52958243-52958265 TTATAATCTGCATTTTTTTGTGG + Intronic
1159494828 18:69189345-69189367 TTTTAGCCTACTTTTTTTTTGGG - Intergenic
1159497338 18:69223013-69223035 CTGTAGCCTACATATTTGAGAGG - Intergenic
1164215438 19:23141098-23141120 ATCTAGCCTAAATTTTTTTTTGG - Intronic
1165236725 19:34428043-34428065 CCTTTGCCTATATTTTTTTGGGG + Intergenic
1165385263 19:35506711-35506733 ATATATCTTAAATTTTTTTGAGG + Intronic
1168440105 19:56357515-56357537 CTATAGCTAACAATATTTTGTGG - Intronic
1202700137 1_KI270712v1_random:158112-158134 CTGTAAGCTGCATTTTTTTGAGG + Intergenic
925740072 2:6997536-6997558 ATGTAGCCAACATTCTTTTGGGG + Intronic
926486545 2:13467839-13467861 CAATGGCTTACATTTTTGTGGGG - Intergenic
927622312 2:24674929-24674951 CCATTCCCTACATTTCTTTGTGG + Intronic
927659287 2:24979269-24979291 CTATACCCCAGATTATTTTGGGG + Intergenic
927743420 2:25592154-25592176 CTCCAGCCTTCATTATTTTGGGG + Intronic
928071441 2:28221479-28221501 ATATGTCATACATTTTTTTGTGG - Intronic
928501366 2:31899848-31899870 CTTTAGCCTACTTTTTGATGGGG - Intronic
928728292 2:34201567-34201589 CTTTGGCCTACATTTCTTTAAGG - Intergenic
929542508 2:42833334-42833356 TTATAGCCCCCACTTTTTTGAGG + Intergenic
930282932 2:49392768-49392790 ATATAGCCTTCATTGTGTTGAGG + Intergenic
930409418 2:51005125-51005147 CTATAACCTACATCTTTCTCTGG + Intronic
930908060 2:56597718-56597740 CTAAAGTGTATATTTTTTTGTGG + Intergenic
931311259 2:61083177-61083199 CTATGGCATTCATATTTTTGTGG - Exonic
931315064 2:61121523-61121545 CTATAGCTTACATTTTTATCAGG - Intronic
931848175 2:66225955-66225977 CAATAACCTACATTTCTTTTTGG + Intergenic
931899096 2:66768120-66768142 CTATTGTGTACATTTGTTTGGGG - Intergenic
933396412 2:81737268-81737290 CTGTAGTCTAAATTTTTTTGGGG + Intergenic
934171070 2:89541587-89541609 CTGTAAGCTGCATTTTTTTGAGG + Intergenic
934281375 2:91615905-91615927 CTGTAAGCTGCATTTTTTTGAGG + Intergenic
935314486 2:101817944-101817966 CTATAGCCTTAATTTTGTTCTGG + Intronic
935800257 2:106688819-106688841 CTATAGCTTACATTCTAATGCGG + Intergenic
935859201 2:107309767-107309789 ATATAGCCTTTATTTTGTTGAGG + Intergenic
935993871 2:108747518-108747540 CCATAGCTCACTTTTTTTTGTGG + Intronic
935995912 2:108772945-108772967 CTTCCACCTACATTTTTTTGTGG + Exonic
937114005 2:119390823-119390845 CTATATCCAAAATTTTTATGAGG + Intergenic
938806233 2:134809260-134809282 CGATAGCCCACATTTTTTTGTGG + Intergenic
939056867 2:137375997-137376019 GTATATTCTACATTTTCTTGTGG - Intronic
939336126 2:140830600-140830622 ATATGGCCTTCATTGTTTTGAGG - Intronic
939476045 2:142687388-142687410 ATAAAGCCTACATTTTCATGTGG - Intergenic
941195578 2:162447267-162447289 CTTTAGCTTTCATTTTTTTCAGG - Intronic
941274781 2:163477765-163477787 CTAAATCCTAGATTTCTTTGGGG - Intergenic
941308591 2:163901211-163901233 ATATAGCCTTTATTATTTTGAGG - Intergenic
942127406 2:172841058-172841080 CCATAGCATGCATTTTTCTGGGG - Intronic
942581608 2:177425170-177425192 GTATTGCCTAGATTTTTTTCTGG + Intronic
943055070 2:182966964-182966986 TTATTTCTTACATTTTTTTGAGG - Intronic
943066331 2:183090692-183090714 TTATAGCCTGCCTTTTTTTTGGG + Intronic
943251888 2:185533359-185533381 CTATAGCCTATTTTTTTGTGTGG + Intergenic
945608859 2:211973093-211973115 CTTTTGCCCACTTTTTTTTGTGG - Intronic
1168941548 20:1716657-1716679 CTATGGCTTTTATTTTTTTGAGG - Intergenic
1170306174 20:14940542-14940564 ATATAGCCTTTATTATTTTGAGG + Intronic
1173068107 20:39734066-39734088 CCATAGTCTGCATTTCTTTGTGG - Intergenic
1177072733 21:16531052-16531074 CTATAGCCACTATTTCTTTGAGG + Intergenic
1178168000 21:30004164-30004186 GTTTAACCTACATTTTTTTTTGG + Intergenic
1182406668 22:30139478-30139500 CTATATCCTAATTTTTTTAGAGG + Intronic
1182531373 22:30961480-30961502 ATATACCCTAAATATTTTTGAGG + Intronic
1182552822 22:31109855-31109877 CTGTGGCCTACATTTTCCTGTGG + Intronic
953050528 3:39338173-39338195 CAGAAGCCTACACTTTTTTGAGG - Intergenic
955491913 3:59491300-59491322 CCTTTGCCTACATTTTTATGGGG + Intergenic
955727250 3:61946477-61946499 CCACAGCCTACATTCTTCTGTGG + Intronic
958679198 3:97304786-97304808 GTATTGCCTACATTTTCTTCTGG - Intronic
959123097 3:102256288-102256310 CTCTAGCCAATATTTCTTTGAGG + Intronic
959239990 3:103778595-103778617 TTATAGCCTAAAGCTTTTTGGGG + Intergenic
960415870 3:117384026-117384048 ATATAGCCTGTATTTTGTTGAGG - Intergenic
960748820 3:120922607-120922629 TTATAGCCTTTATTATTTTGAGG + Intronic
963635390 3:147788459-147788481 CTATAGTTTTCATTTATTTGTGG - Intergenic
964261050 3:154837109-154837131 TTTTAGCCTTCATTTTTTTTCGG + Intergenic
964580740 3:158234232-158234254 CTATAGCATATATTATATTGTGG + Intronic
966487946 3:180491953-180491975 GTATAGTCTACAATTTTTTGAGG - Intergenic
968072734 3:195796723-195796745 TCTTAGCCTGCATTTTTTTGTGG - Intronic
969165658 4:5308746-5308768 GTATGGCCTTCATTTTGTTGAGG - Intronic
970572277 4:17394536-17394558 CAATTGCCTTCATTTTTCTGTGG - Intergenic
971313831 4:25550276-25550298 CTGGAGCTAACATTTTTTTGGGG + Intergenic
971819695 4:31535556-31535578 ATATAGCCTTCATTATTTTGAGG + Intergenic
972135668 4:35890231-35890253 CAATAGCCTACTTTTCTTTGGGG + Intergenic
972892742 4:43578809-43578831 GTATAACTTACATTATTTTGAGG - Intergenic
974786141 4:66621622-66621644 ATTAACCCTACATTTTTTTGAGG + Intergenic
975016396 4:69425941-69425963 CCTTAGCCTACATTTTGTTGGGG + Intergenic
975962441 4:79929127-79929149 CTATTGCCTACAATTTCTGGTGG + Intronic
976995381 4:91425841-91425863 GTATACCTTACATTTTGTTGAGG + Intronic
979243446 4:118470712-118470734 CTGTAGCCTACACTTTAATGGGG + Intergenic
980699777 4:136410144-136410166 CTATAGCCTACTTTTGTGTCTGG - Intergenic
980992352 4:139748655-139748677 CTATAGTCTATATGTTTCTGGGG + Intronic
981106607 4:140888849-140888871 CAATAGCCTACTTTTTATTAAGG - Intronic
984232670 4:177117797-177117819 CTGTAGTGTAGATTTTTTTGGGG - Intergenic
988270210 5:29004096-29004118 ATCTTGCCTGCATTTTTTTGTGG - Intergenic
989315159 5:40069982-40070004 ATATAACTTGCATTTTTTTGGGG - Intergenic
989371932 5:40719592-40719614 CTATATGTTTCATTTTTTTGAGG + Intronic
989451695 5:41594155-41594177 CTATTGACTACATATTTTTACGG - Intergenic
990863040 5:60349749-60349771 CTAAATCCTAAATCTTTTTGAGG + Intronic
990905658 5:60800474-60800496 ATATGGCCTTCATTGTTTTGAGG - Intronic
993289753 5:86051275-86051297 CTATTACTTACATTTTTCTGAGG + Intergenic
995224017 5:109683670-109683692 CTATAGTGTACATGTTTCTGGGG - Intergenic
995265898 5:110160371-110160393 CTAAGGGCTACATTTTTTTCTGG - Intergenic
996251435 5:121338906-121338928 CTATTGCCTACATTTTTGATGGG - Intergenic
996877221 5:128252741-128252763 CAAAAGCCTACTTTTTTTTTTGG + Intergenic
998962748 5:147506254-147506276 CTATAGTTAAGATTTTTTTGGGG + Intronic
999123647 5:149229883-149229905 CTAACGCCCACATTTTATTGTGG - Intronic
999496031 5:152098398-152098420 TTAAAGCTAACATTTTTTTGGGG + Intergenic
1001994721 5:176147199-176147221 TTCTTGCCTACATTTTTCTGTGG - Intergenic
1002086239 5:176777333-176777355 CTCTAGCCTACCTTTTTTGGGGG - Intergenic
1002200840 5:177527224-177527246 CTGTAGCCCAGATTTTTTGGGGG + Intronic
1002827392 6:785750-785772 CTATGGCCTACATTTCAGTGGGG - Intergenic
1003160792 6:3632652-3632674 CTTTAGCCTACTTTTTTCTATGG - Intergenic
1003292963 6:4796465-4796487 CTATACCCTTCATTGTTTTCTGG + Intronic
1005435188 6:25802255-25802277 CTATGGCCTACAATATTTTTAGG - Intronic
1005506577 6:26474473-26474495 CTATTGATTACCTTTTTTTGTGG + Intronic
1006058248 6:31401362-31401384 CCCTAGCCTACACTTTTCTGTGG - Intronic
1006070630 6:31495573-31495595 CCCTAGCCTACACTTTTCTGTGG - Intronic
1006082434 6:31575216-31575238 CTATTGCCTCCATTTCTTTTGGG - Intergenic
1006825036 6:36928569-36928591 CTGCAGCCAACATTTTTCTGAGG - Intronic
1007046359 6:38778992-38779014 CTGTCCCCCACATTTTTTTGTGG + Intronic
1007612167 6:43157185-43157207 TTCTGGCTTACATTTTTTTGTGG - Intronic
1008170969 6:48204856-48204878 ATAGAGCCTAAATATTTTTGAGG + Intergenic
1008450278 6:51642836-51642858 CCATACCTTACTTTTTTTTGAGG - Intronic
1008936149 6:56994757-56994779 ATTTAGCCTACAGTTTTTTGGGG - Intronic
1010378340 6:75200775-75200797 ATGTAACCTACATTTTTTTCTGG - Intronic
1011992565 6:93541328-93541350 TTATTGCCTAGATTTTCTTGTGG - Intergenic
1012341583 6:98131701-98131723 CTAAAGCCTTCATTGATTTGGGG - Intergenic
1012732796 6:102903112-102903134 CTATCTCCTACATCTTTTTAGGG - Intergenic
1013606669 6:111756446-111756468 CTATCTCCTGCATTTTTTTTTGG - Intronic
1013834898 6:114323135-114323157 CAATAGGCTACATTATGTTGAGG - Intronic
1014862792 6:126490727-126490749 ATATAGCCTTTATTGTTTTGAGG + Intergenic
1015392730 6:132701386-132701408 CTATAGCCTTTATTATGTTGAGG - Intronic
1015992163 6:138956663-138956685 GTATAGCTTATCTTTTTTTGAGG - Intronic
1018884944 6:167927462-167927484 CTAAATCCTGCATTTCTTTGTGG - Intronic
1020573693 7:9898492-9898514 GTATAGCCTTTATTATTTTGAGG - Intergenic
1020856461 7:13431793-13431815 CAATAGTTAACATTTTTTTGTGG + Intergenic
1022237037 7:28472374-28472396 CTATGTCATAGATTTTTTTGAGG - Intronic
1022238503 7:28486714-28486736 GTATAGCATACATGGTTTTGTGG - Intronic
1022922024 7:35025206-35025228 CTAGTGCCTAGATTTTTGTGTGG + Intronic
1023690601 7:42782474-42782496 CTATACCTTAAATTTTTTTCTGG + Intergenic
1027127708 7:75568614-75568636 CTATTGCCTGCATTTGTTTTAGG + Intronic
1031896111 7:127349733-127349755 CTATAACCTTCATTTTATTCAGG - Intronic
1032186205 7:129728798-129728820 CTATAGCCTACTTTTTCTGTAGG + Intronic
1033507676 7:142021871-142021893 CTAAAGTATACATTTTTTTCTGG + Intronic
1033999635 7:147396898-147396920 TTATGGTCTACATTTTGTTGTGG - Intronic
1034720256 7:153285589-153285611 ATGTAGCCGACATTTTTATGGGG - Intergenic
1035867381 8:3099551-3099573 CTCTACCCTGCATTTTTATGAGG + Intronic
1036748949 8:11431064-11431086 CTTTTGCCTTCATTTGTTTGGGG - Intronic
1042473694 8:69220637-69220659 GTATTGCCTAGATTTTTTTCTGG - Intergenic
1042842921 8:73142401-73142423 CTATAGAATACATTTGTTTGAGG + Intergenic
1042994256 8:74677803-74677825 CTATAGCCATTATTCTTTTGGGG - Intronic
1042998028 8:74722189-74722211 ATAGAGCCTTGATTTTTTTGAGG - Intronic
1045105859 8:98892074-98892096 CTATAGCATAGATTTTTTTTTGG - Intronic
1046199702 8:110908768-110908790 ATATAGCCTTTATTATTTTGAGG + Intergenic
1046906581 8:119580286-119580308 CTATATCATACATTCTTTCGAGG + Intronic
1047986190 8:130236289-130236311 CTGGAGCCTACCATTTTTTGTGG + Intronic
1048714161 8:137248867-137248889 ATATGGCCTTCATTATTTTGAGG - Intergenic
1050384240 9:5068704-5068726 CTATATGCTACATTTGTTTTAGG + Intronic
1051011967 9:12427484-12427506 ATATGGCCTTCATTGTTTTGAGG - Intergenic
1051019245 9:12521150-12521172 GTATAGCCTACATTCTGGTGGGG - Intergenic
1051079025 9:13275308-13275330 CTATAGCCTAATTTTTTATAAGG - Intronic
1052707709 9:32013141-32013163 CTATTTCCTACATATTTGTGAGG + Intergenic
1052954156 9:34240062-34240084 TTATAGCCTCCATTTTTATTAGG + Intronic
1056508166 9:87277157-87277179 CTGGGGCCTGCATTTTTTTGTGG - Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057425966 9:94950039-94950061 GTATAGGCTACATTTGTGTGTGG + Intronic
1057596647 9:96419980-96420002 ATATAGCCTCCATTTTCTGGAGG + Intergenic
1058143140 9:101379701-101379723 CTAAATCCTAAATTATTTTGTGG + Intronic
1058471839 9:105287625-105287647 CTATAGCATGCATTGTTTTCAGG - Intronic
1058567193 9:106298803-106298825 CAAGAGCCTACAGTTTCTTGGGG - Intergenic
1186256097 X:7721698-7721720 CTATAGGCTATATTTGTTTTGGG + Intergenic
1187461029 X:19486861-19486883 CTATCGCCGACATTCTTTTCTGG - Intronic
1188347638 X:29086973-29086995 CTATAACATACTATTTTTTGAGG - Intronic
1189807517 X:44750422-44750444 CTTTGGCATACAGTTTTTTGGGG + Intergenic
1189957502 X:46290682-46290704 ATATAGCCTATATTGTGTTGAGG + Intergenic
1190585595 X:51937153-51937175 ATATGGCCTTCATTTTTTTGAGG - Intergenic
1191758022 X:64615489-64615511 ATATAGCCTTCGTTATTTTGAGG + Intergenic
1193517404 X:82485100-82485122 ATATGGCCTTCATTATTTTGAGG - Intergenic
1193623801 X:83791784-83791806 ATATAGCCTTCATTACTTTGAGG - Intergenic
1194478419 X:94389462-94389484 CTATATCCTAACTTTGTTTGTGG + Intergenic
1194725794 X:97395333-97395355 GTAAAGCCAAAATTTTTTTGTGG - Intronic
1194737040 X:97524883-97524905 CTATAGCCTACAGTTCTTCCTGG + Intronic
1195892167 X:109707887-109707909 TTATAGCCTACATAAATTTGAGG - Intronic
1197028246 X:121782109-121782131 CTATAGCCTACATTTCCTGAAGG + Intergenic
1197360366 X:125494152-125494174 CAATAGACTACACTTATTTGAGG + Intergenic
1197832511 X:130659684-130659706 CAATAGTCTACATTTTTGTTAGG - Intronic
1198813624 X:140562231-140562253 ATATAGCCTTCATTAATTTGAGG + Intergenic
1200273069 X:154705587-154705609 ATATAGCCTTTATTATTTTGAGG - Intronic
1201052168 Y:9947317-9947339 GAATAACCTACATTTTCTTGTGG - Intergenic