ID: 1154936479

View in Genome Browser
Species Human (GRCh38)
Location 18:21063060-21063082
Sequence ATCTGGCAAGGGTCATTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154936473_1154936479 12 Left 1154936473 18:21063025-21063047 CCACAGAATGGGTAATTTATAAA No data
Right 1154936479 18:21063060-21063082 ATCTGGCAAGGGTCATTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154936479 Original CRISPR ATCTGGCAAGGGTCATTCAA TGG Intronic