ID: 1154938171

View in Genome Browser
Species Human (GRCh38)
Location 18:21082580-21082602
Sequence CTGTATCTAATGAGGTGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154938171 Original CRISPR CTGTATCTAATGAGGTGATG TGG (reversed) Intronic
900007316 1:69855-69877 ATTTATCTAATGACTTGATGGGG - Exonic
901536973 1:9888903-9888925 CTGTATTGAATGAGGTCAGGTGG - Intronic
902079258 1:13810040-13810062 CTGGGTTTAATGAGGTCATGAGG - Intronic
906869254 1:49458799-49458821 CTGTGTCTATTGAGATGATCAGG + Intronic
906995125 1:50784994-50785016 GTGTATGTTATGAGGTTATGAGG - Intronic
908905937 1:69009018-69009040 CTGTATCTTTTTAGGGGATGTGG - Intergenic
910625836 1:89305481-89305503 CTGTCCCAAGTGAGGTGATGGGG + Intergenic
911298433 1:96145791-96145813 CTGTATGGCATGAGGTAATGGGG - Intergenic
912614377 1:111083199-111083221 CTGTGTCTATTGAGATGATTAGG + Intergenic
913119699 1:115728476-115728498 ATGTAGATGATGAGGTGATGAGG + Intronic
913459779 1:119072059-119072081 CTGTATATAATGGGGTCATGTGG + Intronic
914698315 1:150106649-150106671 CTGAAAATAATGGGGTGATGGGG - Intronic
915901836 1:159852843-159852865 TTGTATTTGATGAGCTGATGAGG - Intronic
917193268 1:172441483-172441505 CTGTAACATATGAAGTGATGTGG - Exonic
917998250 1:180463955-180463977 CTGCATCTATTGAGATAATGTGG - Intronic
918112359 1:181468134-181468156 ATGTATCTAGAGATGTGATGTGG - Intronic
920970028 1:210735173-210735195 CTGCATCTAATCAGATGAGGGGG - Intronic
921440074 1:215175207-215175229 CTGCATCTATTGAGGTAATCAGG + Intronic
921910152 1:220539611-220539633 CTGCATCTATTGAGATGATCAGG + Intronic
922390284 1:225134465-225134487 CTGTATCTATTGAGATAACGTGG + Intronic
923694727 1:236236663-236236685 ATGTCTCTAATAAGGTGAAGGGG - Intronic
1064596646 10:16952351-16952373 CAGTATCAAATGAGCTGGTGAGG + Exonic
1068116451 10:52741829-52741851 CTGTTTCTTATGAGAGGATGAGG + Intergenic
1071941564 10:90596836-90596858 CTGTTTCTAATGAGGCCAGGAGG + Intergenic
1074752333 10:116598786-116598808 CTGTATCTAATGAGGCCAAAAGG + Intronic
1077906955 11:6542010-6542032 CTGGATATAAAGAGGTGATAAGG - Intronic
1079836982 11:25347869-25347891 ATATATGTTATGAGGTGATGAGG + Intergenic
1080143335 11:28948982-28949004 GTGTAACTAATGTGGAGATGGGG - Intergenic
1080521915 11:33075104-33075126 CTGTAACAAATGAAGTGATGTGG - Intronic
1080670105 11:34368193-34368215 CTGCATCTATTGAGATGATCAGG - Intergenic
1081171699 11:39877486-39877508 CTGCATCTATTGAGATCATGTGG - Intergenic
1083618623 11:64038151-64038173 CTGTTTCTAAGGAGGTGATGGGG + Intronic
1086647044 11:89235584-89235606 CTGCATCTAAAGAGATTATGTGG - Intronic
1092026613 12:5246133-5246155 CTGTATCAACTCAGGTGATGGGG - Intergenic
1092393397 12:8102082-8102104 CTGCATCTATTGAGATGATATGG - Intergenic
1093178928 12:15945970-15945992 CTGCATCTATTGAGATAATGTGG + Intronic
1093218972 12:16396186-16396208 CTGCATCTATTGAGATGATCAGG - Intronic
1094694641 12:32805954-32805976 CTGCATCTATTGAGATCATGTGG + Intronic
1096346704 12:50854213-50854235 CTGTATCTATTGAGATGATGTGG - Intronic
1096819467 12:54222569-54222591 CTGTAAATGATGAGATGATGTGG + Intergenic
1098300572 12:69049797-69049819 CTGCATCTATTGAGGTGATCAGG - Intergenic
1099875810 12:88404471-88404493 CTGCATCTATTGAGATGATCAGG - Intergenic
1100001583 12:89843434-89843456 CTGTAGCTGAGGAGGTGAGGAGG - Intergenic
1101171662 12:102103770-102103792 CTGCATCTTTTGAGATGATGTGG - Intronic
1101611386 12:106295542-106295564 TTGTATATAATGAGGAAATGTGG - Intronic
1103967051 12:124646566-124646588 CTGTGTCTAATTAGGGGTTGTGG - Intergenic
1106473507 13:30078144-30078166 CTGGAGCTAATCAGGTGAGGGGG + Intergenic
1108789793 13:53954669-53954691 TTGTATCTAAGCAGTTGATGTGG + Intergenic
1110203023 13:72875729-72875751 CTGTATCTTCTTTGGTGATGTGG + Intronic
1113160812 13:107378864-107378886 CTGTTTTTAATGAGGTGTTATGG + Intronic
1115894740 14:38073717-38073739 TTATATCTATTGAGGTGCTGTGG + Intergenic
1116732270 14:48638975-48638997 TTGTTTCTAATGAGGTTATTTGG - Intergenic
1117560816 14:56936596-56936618 CTCTATCTAATGAAGTGCTGTGG - Intergenic
1117773684 14:59160411-59160433 CTGAACCTAGTGAGGTGATCAGG - Intergenic
1118861276 14:69665602-69665624 CTGTCTCTTATGAGGTGGAGTGG + Intronic
1119947139 14:78706656-78706678 CTGTATCTAATGGGATGGAGAGG + Intronic
1120206369 14:81591291-81591313 ATATGACTAATGAGGTGATGTGG - Intergenic
1120238590 14:81923029-81923051 CTGGAATTAATGAGGAGATGGGG + Intergenic
1131658628 15:94489151-94489173 CTGCATCTAATGAGATAATATGG - Intergenic
1132446236 15:101922273-101922295 ATTTATCTAATGACTTGATGGGG + Exonic
1134253894 16:12595556-12595578 CTGCATCTATTGAGATAATGTGG - Intergenic
1134366155 16:13581243-13581265 CTGGCTGTAAGGAGGTGATGAGG - Intergenic
1138335824 16:56252111-56252133 CTGTATCAAATGAGCTGATCAGG + Intronic
1140609804 16:76584328-76584350 CTGTATATTATGTGGTGCTGAGG + Intronic
1140687919 16:77451331-77451353 CTGTGACTAGTGTGGTGATGAGG + Intergenic
1147157546 17:38551877-38551899 CTGTGTCTGTTGAGGTGCTGGGG - Exonic
1147255868 17:39181691-39181713 CTGTTTCTAATGAGATAAAGGGG - Intronic
1148187848 17:45657459-45657481 CTGTATAAAATGAGGAGCTGAGG - Intergenic
1153077607 18:1183163-1183185 CTTTATCCAAAGAGGAGATGGGG + Intergenic
1153399779 18:4670828-4670850 CTGCATCTATTGAGGTTATGTGG - Intergenic
1154938171 18:21082580-21082602 CTGTATCTAATGAGGTGATGTGG - Intronic
1155198262 18:23495300-23495322 CTGTATAAAATGGGGAGATGTGG - Intergenic
1160639074 19:111443-111465 ATTTATCTAATGACTTGATGGGG - Exonic
1162594745 19:11619558-11619580 CTGTATTTGATGCAGTGATGAGG + Intergenic
1162889780 19:13724172-13724194 ATGTAACAAATGAGGAGATGAGG + Intergenic
1166486885 19:43221501-43221523 CTGTATCTAATCCGGTGGGGAGG - Intronic
1167580353 19:50337616-50337638 CTGAACCTACTGAGGGGATGGGG - Intronic
1167993716 19:53385014-53385036 CTCCATCTACTAAGGTGATGTGG + Intronic
1168006503 19:53494023-53494045 CTCCATCTATTGAGATGATGTGG + Exonic
926332041 2:11833616-11833638 CTGTTTCCAGTGAGGTGAAGTGG + Intergenic
926773458 2:16398859-16398881 CTGTTTATAATGGGGTGATGTGG + Intergenic
927089086 2:19696827-19696849 CTGAACTTAATCAGGTGATGTGG + Intergenic
927610424 2:24533686-24533708 CTGCATCTATTGAGATAATGTGG + Intronic
930965378 2:57317501-57317523 CTGCATCTATTGAGATGATCAGG - Intergenic
937566776 2:123302076-123302098 CTGTATTTATTGAGGTAATCAGG - Intergenic
939088081 2:137745569-137745591 CTGTCTCTAATGATGTGAAGTGG + Intergenic
939769881 2:146302272-146302294 CTGCATCTACTGAGATGATCAGG - Intergenic
942780251 2:179633454-179633476 CTGTATCTATTGAGATAATCAGG - Intronic
943093498 2:183401718-183401740 CTGCATCTATTGAGATGATCAGG + Intergenic
943544725 2:189260544-189260566 ATGTGTTCAATGAGGTGATGAGG + Intergenic
943977762 2:194505584-194505606 CTGCATCTATTGAGATGATCAGG + Intergenic
945568393 2:211433253-211433275 CAGTATACAATTAGGTGATGTGG + Intronic
947091394 2:226515683-226515705 TTGTATTTAATGAGAAGATGGGG - Intergenic
948798181 2:240417029-240417051 CTGTCTCTGATGAGGTCATGGGG - Intergenic
1169412748 20:5386759-5386781 CTGTATCTATTGAGATCATATGG - Intergenic
1169512761 20:6283158-6283180 CTGTTTCTACTGAGATGTTGGGG - Intergenic
1170434763 20:16315025-16315047 ATGTGGCTGATGAGGTGATGTGG + Intronic
1172806501 20:37615600-37615622 ATGTATCTAGTGGAGTGATGGGG - Intergenic
1172867182 20:38109261-38109283 CTCTATCTCATAAGGTTATGGGG + Intronic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1173313451 20:41921346-41921368 CTGTCTCTGATGAGGCTATGAGG + Intergenic
1175383069 20:58577022-58577044 CTGAGTCTGATGAGGTGGTGGGG + Intergenic
1176122575 20:63460704-63460726 CTGAATGTGATTAGGTGATGAGG - Intronic
1177305288 21:19307271-19307293 CTTTATCTGGTGGGGTGATGTGG - Intergenic
1177895501 21:26852368-26852390 ATGTATTTAATGAGATTATGAGG + Intergenic
1180072967 21:45446899-45446921 CTGCATCTATTGAGATGATTGGG - Intronic
1181434223 22:22900890-22900912 CAGTATATGATGAGGTGTTGGGG - Intergenic
1181435159 22:22906256-22906278 CAGTATATGATGAGGTGTTGGGG - Intergenic
1181714510 22:24714362-24714384 ATGTATTTAATGATGTGTTGGGG - Intergenic
1184203523 22:42985715-42985737 CTGAATATAATGTGGTGAAGAGG - Intronic
949691166 3:6641297-6641319 TTCTATCTATTGAGGTGTTGAGG - Intergenic
952551171 3:34478860-34478882 CTGCATTTAGTGAGATGATGCGG + Intergenic
956355188 3:68383423-68383445 CTGCATCTATTGAGATAATGTGG + Intronic
957723363 3:84032556-84032578 CTGTTGCTGGTGAGGTGATGTGG - Intergenic
957746067 3:84345030-84345052 CTGCATCTATTGAGATAATGTGG + Intergenic
958651186 3:96938848-96938870 CTGCATCTATTGAGATAATGTGG + Intronic
959203489 3:103277834-103277856 CTGCATCTATTGAGATGATCAGG + Intergenic
962621468 3:137184423-137184445 ATTTATTTAATGACGTGATGTGG + Intergenic
962737358 3:138337849-138337871 CTGCATCTAATGAGGGCCTGAGG + Intergenic
965359457 3:167720053-167720075 CTGTGTTTAATGAGGTGAGTTGG - Exonic
968015038 3:195322343-195322365 CAGTATCTACTGAGATGCTGGGG + Intronic
968440493 4:621566-621588 CTGTGTGTAATGAGGAGATGCGG - Intergenic
972161463 4:36233186-36233208 GTGTATCTAATGATGTGCTTGGG - Intronic
973958223 4:56084624-56084646 CTATGTCTGATGAGATGATGGGG + Intergenic
974194335 4:58552291-58552313 CTGCTTTTAATGAGGTAATGAGG - Intergenic
974262985 4:59548470-59548492 CTGTTTCTAAAGTGGTGCTGTGG + Intergenic
974392923 4:61296209-61296231 CTGTGTCAAATTATGTGATGAGG + Intronic
975088426 4:70371543-70371565 CTGCAAGTAATGAGGTGAGGTGG - Intronic
977151385 4:93516917-93516939 CTGTATAGAATGAGGTTATAAGG - Intronic
980531017 4:134054534-134054556 CAGGAACTAATGAGGTGATAGGG - Intergenic
980618652 4:135268053-135268075 CTGTATCCTATGATGTGGTGAGG + Intergenic
980759016 4:137203620-137203642 CTGTATCTCATGAAGAGAAGTGG - Intergenic
983112158 4:163765076-163765098 CTGCATCTAATGAGGTTACATGG + Intronic
983824924 4:172247731-172247753 CTGTATCTACTGGGGTGGGGTGG - Intronic
984116889 4:175693060-175693082 TTGTATCTGATTAGCTGATGTGG + Intronic
984242821 4:177237755-177237777 AGATATCTAATGAGGTGACGTGG - Intergenic
986060385 5:4184060-4184082 CTGCATCTATTGAGATGATCAGG + Intergenic
988850813 5:35179123-35179145 CTGTATGTAGTGAGATGAAGAGG - Intronic
990922656 5:60984636-60984658 CTGCATCTATTGAGATAATGTGG + Intronic
994039523 5:95243119-95243141 CTGTCTCTGATGATGTGATCAGG + Intronic
994527271 5:100922109-100922131 CTGCATCTATTGAGATGATCAGG + Intergenic
995166000 5:109042445-109042467 CTCTATCCAAAGAGGTGAGGAGG - Intronic
996193988 5:120580768-120580790 CTGCATCTATTGAGATAATGTGG + Intronic
997032103 5:130142234-130142256 CAGTATCTACTGAGGAGATGGGG + Intronic
998654197 5:144157627-144157649 ATGTATCTAATGACATGATTTGG - Intergenic
1000401298 5:160830179-160830201 CTGCATCTATCGAGGTTATGTGG + Intronic
1006178329 6:32137524-32137546 CTATATTTAATCAAGTGATGAGG + Intergenic
1012830112 6:104193759-104193781 TTGTATCTATTGAGATGATATGG - Intergenic
1013216751 6:108034508-108034530 CTGTATACAATGATGTGATGTGG - Intergenic
1014393216 6:120891252-120891274 CTGTGTCTATTGAGATAATGTGG + Intergenic
1015362051 6:132351380-132351402 CTGCATCTATTGAGATGATCAGG + Intronic
1016100110 6:140089379-140089401 CAGTATCTAATGTGGTTTTGGGG + Intergenic
1017088928 6:150741415-150741437 GGGAATCTATTGAGGTGATGGGG - Intronic
1018897927 6:168034143-168034165 ATGTATCTGATGAGATTATGGGG - Intronic
1019872036 7:3773640-3773662 TTGAATCTAATGAGGTAATATGG + Intronic
1021839393 7:24710152-24710174 CTGTATCCCAAGAGGTGGTGTGG - Intronic
1022879090 7:34567077-34567099 CTGTACCTAATGACCTGAGGTGG - Intergenic
1029888435 7:103899700-103899722 CTGCATCTATTGAGATAATGTGG - Intronic
1030284306 7:107809827-107809849 CTGTAACAAATGAAGTGATGTGG + Intergenic
1030692534 7:112550860-112550882 CTATATCTATTGTGTTGATGGGG + Intergenic
1031002058 7:116427121-116427143 GTGTAGCTAATGAAATGATGGGG + Intronic
1031292122 7:119950970-119950992 CTGTATCTAACTATCTGATGGGG - Intergenic
1034473829 7:151271165-151271187 CTTTGTCTGATGAGGTGGTGAGG + Intronic
1036825874 8:11975444-11975466 CTGTCTCTCTTGGGGTGATGAGG + Intergenic
1038997592 8:32942350-32942372 CTGTATCTATTGAGGTGATATGG + Intergenic
1039395140 8:37219384-37219406 GTGTATCTAAGAAGGTGAGGAGG + Intergenic
1040903799 8:52444205-52444227 CTCCATCTATTGAGATGATGTGG + Intronic
1041183461 8:55273004-55273026 CTGTCTCTAAGGGTGTGATGTGG + Intronic
1042844013 8:73152208-73152230 CTGTTTCTACTGAGGTCACGAGG + Intergenic
1044737404 8:95293246-95293268 CTGTATTTGAACAGGTGATGGGG - Intergenic
1046038198 8:108870131-108870153 CTTCATCTTATTAGGTGATGAGG + Intergenic
1047338282 8:123956386-123956408 CTTTATCTAATGTAATGATGTGG + Intronic
1048743246 8:137585552-137585574 CTGTGCCAACTGAGGTGATGAGG - Intergenic
1048864387 8:138748848-138748870 TTGTATCTAAGAAGGTGATATGG + Intronic
1050675641 9:8049678-8049700 CTGTATCTATTCAGGTGATCAGG + Intergenic
1050830356 9:10003241-10003263 CTGGATCTATGGAGATGATGAGG + Intronic
1050840158 9:10138800-10138822 CTGAATCTATTGAGGTCATATGG - Intronic
1051956626 9:22702827-22702849 CTGTATCTATTGAGATAATCAGG + Intergenic
1051976386 9:22955019-22955041 CTGTTTCTAATTAGCTGAGGTGG - Intergenic
1053751199 9:41257775-41257797 ATGTATTTAATGAAGTGATCCGG - Intergenic
1054256721 9:62822104-62822126 ATGTATTTAATGAAGTGATCCGG - Intergenic
1054334586 9:63793508-63793530 ATGTATTTAATGAAGTGATCCGG + Intergenic
1056115757 9:83439672-83439694 ATGTATCTAATGATGTGTTCAGG - Intronic
1056871345 9:90283415-90283437 CTGCATCTACTGAGTTGATGTGG - Intergenic
1056991032 9:91411200-91411222 CTGTATTTAATGAGGCGAAATGG + Intronic
1057306479 9:93915224-93915246 CTATATGAAATGAGGTGAGGTGG + Intergenic
1062157677 9:135062483-135062505 CTGACTCTCGTGAGGTGATGTGG + Intergenic
1187109865 X:16286112-16286134 CAGCAACTAATGGGGTGATGGGG - Intergenic
1187140880 X:16592476-16592498 CTGGATCTAGGGAGGTGCTGTGG - Intronic
1188442224 X:30223712-30223734 CCGTATATAAAGAAGTGATGAGG - Intergenic
1191147860 X:57187805-57187827 CTGCATCTATTGAGATAATGTGG + Intergenic
1192675228 X:73188739-73188761 CTGCATCTATTGAGATCATGTGG - Intergenic
1193719125 X:84967615-84967637 CTGCATCTATTGAGGTAATCAGG + Intergenic
1196000658 X:110781781-110781803 CAGTATATATTGATGTGATGAGG + Intronic
1196027788 X:111060170-111060192 CTGTATCTATTGAGATAATGTGG + Intronic
1196708127 X:118734554-118734576 CTGTATCAATTGAGATGATCAGG + Intronic
1198679004 X:139161245-139161267 CTGCATCTATTGAGATAATGTGG - Intronic
1198691997 X:139294523-139294545 CGGTACAAAATGAGGTGATGAGG + Intergenic
1202362250 Y:24123240-24123262 CTGTAGCTAATAAGATAATGCGG - Intergenic
1202362823 Y:24129856-24129878 CTGTAGCTAATAAGATAATGCGG + Intergenic
1202507955 Y:25540259-25540281 CTGTAGCTAATAAGATAATGCGG - Intergenic
1202508529 Y:25546875-25546897 CTGTAGCTAATAAGATAATGCGG + Intergenic