ID: 1154938649

View in Genome Browser
Species Human (GRCh38)
Location 18:21088728-21088750
Sequence ATGATGAACAGGTTTGATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154938645_1154938649 -2 Left 1154938645 18:21088707-21088729 CCTTATAAGTATATTAATGCCAT 0: 1
1: 0
2: 5
3: 56
4: 473
Right 1154938649 18:21088728-21088750 ATGATGAACAGGTTTGATTAGGG 0: 1
1: 0
2: 0
3: 10
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154938649 Original CRISPR ATGATGAACAGGTTTGATTA GGG Intronic
904807142 1:33140193-33140215 ATGAGGAACAGGGATGCTTACGG + Intergenic
906489008 1:46253211-46253233 GATATGAACAGGTTTGTTTATGG + Intronic
909450662 1:75795083-75795105 ATGATTGATAGGTTTGAATATGG + Intergenic
910633518 1:89381983-89382005 ATGATGAACAGTAATGACTAAGG - Intronic
911518416 1:98897884-98897906 ATGATGAATAAGTTTGAGTAGGG - Intronic
913512273 1:119572738-119572760 ATGGTGAACAAGTTTCCTTAAGG - Intergenic
915109781 1:153555939-153555961 AGGATGTTCAGGTTTGATTCAGG - Intergenic
915890039 1:159764717-159764739 CTGAGGAACAGGTTGGATTTAGG - Intergenic
915958773 1:160246228-160246250 ATGGTAAAGAGTTTTGATTATGG - Intronic
922142875 1:222907649-222907671 ATGATTTAAAGATTTGATTATGG + Intronic
923516548 1:234702568-234702590 ATGATGAACATTTCTGATTCTGG + Intergenic
1066049451 10:31620527-31620549 ATGAATAACAGGTTTCTTTAAGG + Intergenic
1068087013 10:52386701-52386723 ATGATGAAAAGGTTTGTTTTTGG - Intergenic
1068405209 10:56579092-56579114 ATTATGAATTGGTTTTATTATGG - Intergenic
1068515326 10:58018613-58018635 ATGATGAACAGTCTTTATTAAGG - Intergenic
1068637594 10:59364139-59364161 AAGAAAAACAGGTTTCATTAAGG + Intergenic
1069149869 10:64947080-64947102 ATGATGAACAGGGTTGAACTGGG + Intergenic
1075843913 10:125529484-125529506 ATGCTGAGCAGGGTTGATTCAGG - Intergenic
1079361722 11:19776046-19776068 ATTATGAACAGTTTTGACTACGG + Intronic
1080081975 11:28231825-28231847 ATGATGAAAAGCTTGGATAAAGG - Intronic
1085337837 11:75710132-75710154 ACCATGAACAGGTAGGATTAAGG - Intergenic
1085866451 11:80300349-80300371 ATGATGAACTGGTAAGATTCAGG - Intergenic
1086010434 11:82096558-82096580 ATGATAAATAGGTTGGATGATGG + Intergenic
1087974185 11:104524192-104524214 ATGATGAAAACCTTTGATTGGGG - Intergenic
1088425794 11:109700551-109700573 ATGTTGAACAGGTGTGGTGAGGG - Intergenic
1093843423 12:23935248-23935270 ATGATGAACTGATTTTATTTGGG - Intronic
1094391273 12:29953102-29953124 AATATGATCAGGTCTGATTAAGG - Intergenic
1102477146 12:113195997-113196019 ATGCTGAACAGCTTAGCTTAGGG - Intronic
1103139611 12:118537095-118537117 AGGATGAACAGGATTAATTTAGG + Intergenic
1106237817 13:27879661-27879683 AAGATGAAGAGGTCTGAATATGG + Intergenic
1109527383 13:63594131-63594153 ATCAAAAACAGGTTTGAATAGGG - Intergenic
1109594833 13:64537571-64537593 CTCATAAACAGGTTTGATAATGG - Intergenic
1109997794 13:70152653-70152675 ATGATAAACAAGTGAGATTAAGG + Intergenic
1112935101 13:104787311-104787333 ATGATGCACTGGTTAGAATAAGG + Intergenic
1113507369 13:110826482-110826504 ATGATGGACAGGTATGTTCAGGG + Intergenic
1113507385 13:110826590-110826612 ATGATGGACAGGTATGTTCAGGG + Intergenic
1116232319 14:42233145-42233167 ATTAGGAACTGGTTTGGTTATGG - Intergenic
1118027460 14:61783899-61783921 TTGATTAACAGGTTTACTTAAGG + Intronic
1119116822 14:72030468-72030490 ATCATGGACATGGTTGATTATGG + Intronic
1121564183 14:94896278-94896300 ATGCTGAGCAGGTTTGATCTCGG + Intergenic
1124915076 15:33962339-33962361 ATGAGGAACAGGTTTGGGAAAGG - Intronic
1124922941 15:34044126-34044148 ATGATGCAGAAGTTGGATTAGGG - Intronic
1126561898 15:50053054-50053076 ATGATGCACAGCTTGGATCAGGG + Intronic
1127612550 15:60651095-60651117 ATACTGAACAGTTTTGATTAGGG + Intronic
1128718809 15:69930403-69930425 AAGTTAAACAGGTTTGTTTATGG - Intergenic
1130731697 15:86500221-86500243 ATGATGCACAGGTTTGTGGAGGG + Intronic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1143410578 17:6706057-6706079 ATTATGATCATGATTGATTATGG + Intronic
1144108035 17:12003861-12003883 ATGTTGAACAGGCTTGAGTCAGG + Intergenic
1144596700 17:16575925-16575947 ATGATAAACAGGTCTGGTCAAGG - Intergenic
1145299408 17:21621386-21621408 ATGATGAACTGTTTTTAATATGG + Intergenic
1146142710 17:30381477-30381499 TTGAAGAACAGATATGATTAGGG - Intronic
1146958326 17:36950228-36950250 GTGATTGACAGGTTTGATGAAGG + Exonic
1147445356 17:40471980-40472002 ATGATGGCCAGGTTTGGATAAGG - Intergenic
1148968399 17:51457443-51457465 ATTATAAACAGGTTTAATTGAGG + Intergenic
1150759961 17:67952770-67952792 ATGATGAATACGTTACATTAGGG - Intronic
1154289417 18:13094376-13094398 ATGAGGAAGAGGTTTGCTTTTGG + Intronic
1154938649 18:21088728-21088750 ATGATGAACAGGTTTGATTAGGG + Intronic
1155043558 18:22084965-22084987 ATGAGGATCAGGTTTAATTTAGG - Intergenic
1155710107 18:28866375-28866397 CTGCTGAACAGTTTTGACTATGG - Intergenic
1156794770 18:41030817-41030839 ATGTTGAAAAGCTATGATTAAGG + Intergenic
1164558479 19:29271304-29271326 ATGACTAACAGATGTGATTAAGG - Intergenic
1165425363 19:35742586-35742608 ATGCTGAACAGATTACATTATGG + Exonic
926948300 2:18213497-18213519 AAGCTGAACAGCTTTAATTAGGG - Intronic
928216431 2:29365347-29365369 TTGATGAACAGATGGGATTAGGG + Intronic
930259790 2:49132168-49132190 ATGATGTACTGCTTTGTTTAGGG + Intronic
930441223 2:51409240-51409262 ATGATGTACAAGTTTGATTTGGG + Intergenic
930693339 2:54386760-54386782 ATAAAGAACAGGTGTGCTTATGG - Intergenic
930871511 2:56175740-56175762 AGGATGTGCAAGTTTGATTAGGG - Intergenic
931022000 2:58056549-58056571 AAGCAGAACAGGTTGGATTAAGG - Intronic
932612386 2:73209527-73209549 ATGAGGAACATGTTTCAATAAGG - Intronic
933485118 2:82911611-82911633 ATGATGAAAAAGAATGATTATGG - Intergenic
933870039 2:86557224-86557246 GGGATGAACAGGTTTGACTGGGG + Intronic
937549685 2:123072331-123072353 TTGATTAACATGTTGGATTATGG - Intergenic
938940540 2:136165830-136165852 ATTATGAACAAGATTCATTATGG + Intergenic
939406393 2:141763603-141763625 ATGATGGCCAGGTTTCAGTATGG + Intronic
941455051 2:165705200-165705222 ATGGTTAACAGGTTTCTTTATGG - Intergenic
943998965 2:194808061-194808083 AAGATGAATAGGATTGATCAGGG + Intergenic
944597126 2:201271130-201271152 ATACTGACCAGTTTTGATTAGGG + Intronic
946511999 2:220367911-220367933 AGGATGAAAAAGTCTGATTATGG - Intergenic
948150799 2:235743203-235743225 ATGGTGAACATGTTAGATTGGGG + Intronic
1168926923 20:1589150-1589172 ATCATTAAAAGGTTTGAATAAGG - Intronic
1173288159 20:41691417-41691439 ATGAGAAACAGGTTTAATTCTGG - Intergenic
1173436605 20:43038108-43038130 AATATTAACATGTTTGATTAAGG + Intronic
1173630712 20:44512765-44512787 ATGATTAACTGGTTACATTATGG - Intronic
1174541507 20:51293288-51293310 ATGATGATCAGGATTGAGGATGG - Intergenic
1178982051 21:37272629-37272651 ATTATGTACAAGTTTGATTAAGG + Intergenic
1179263111 21:39776014-39776036 ATGATGAAAAGATTGGATTATGG + Intronic
1181294864 22:21829027-21829049 ATGATTATCAGTTTTGTTTAGGG - Intronic
1182392255 22:30008292-30008314 AACATGAACAGGTCTTATTATGG - Intronic
1182608032 22:31522430-31522452 ATGATGAAAAGTTTTGGGTATGG - Intronic
950961076 3:17108437-17108459 ATGCTGCACAGGTTTAATTCTGG + Intergenic
952486920 3:33821559-33821581 ATGAGGAATTGGTTTGATTGTGG + Intronic
958020577 3:87990142-87990164 AGGATGAACAAGTTTTATTGGGG - Intergenic
960915107 3:122686954-122686976 ATAATGAAAAGGTCTGATAAGGG - Intronic
961001999 3:123380259-123380281 GTGGTGAACAGGCTTGAGTAGGG + Intronic
965627639 3:170697662-170697684 ATGATGAACAAATGTGATGATGG - Intronic
967672200 3:192250264-192250286 AAGAAAAACAGTTTTGATTAGGG + Intronic
968259848 3:197312026-197312048 ATGATGAACATGTGAGGTTATGG - Intergenic
969269709 4:6091106-6091128 ATGGGCAACAGGTTTGCTTAAGG + Intronic
971911773 4:32803734-32803756 ATGTTGTACAGGTTTGAGTAGGG - Intergenic
972644714 4:40956275-40956297 ATCATGAATAGGTTTGCTGAGGG + Intronic
972839056 4:42909710-42909732 ATGATGAACAGATTAGCTGAGGG - Intronic
974120182 4:57628353-57628375 ATGATGAAAATGTTTGGCTAGGG + Intergenic
974206586 4:58710701-58710723 GTAATGAACAGCTTTGATCATGG - Intergenic
974620941 4:64353542-64353564 ATGATACACAGGTTTGAAGATGG + Intronic
975176951 4:71300046-71300068 ATGAAAAATGGGTTTGATTAAGG - Intronic
975795640 4:78004208-78004230 ATGAAAAACAGATATGATTAAGG - Intergenic
975961703 4:79916765-79916787 GTGATGAACAGGATTTATGAAGG + Intronic
976195211 4:82525629-82525651 ATGCTTAACAGCTTTGAATATGG + Intronic
976837261 4:89389214-89389236 ATGATGAACAGGCTGGAACAAGG - Intergenic
978643594 4:110901323-110901345 AAGATTACCAGGTTTGATTCAGG - Intergenic
979589127 4:122458189-122458211 ATGAAGAAAAGGTCAGATTAGGG + Intergenic
980614783 4:135205160-135205182 ATGATGAACAGATTTGTGTCAGG - Intergenic
981266092 4:142785005-142785027 TTGCTGTACAGGTTTGAGTAGGG - Intronic
981724936 4:147837244-147837266 ATAATGAATTGGTTTAATTAGGG + Intronic
981894588 4:149783205-149783227 ATGAAGAATAGGTTTTATTGTGG - Intergenic
983168217 4:164505196-164505218 ACCATGAGCAGGTTTGTTTAAGG + Intergenic
986312645 5:6565304-6565326 GGGATGAACAGGTTTGTTTGAGG - Intergenic
994824319 5:104694232-104694254 ATGATGACCAGGGTGAATTATGG - Intergenic
996354375 5:122579937-122579959 ATGAGGGAAAGGATTGATTAGGG - Intergenic
1005326370 6:24705041-24705063 ATGAAGAAAAGCTTTGCTTAAGG - Exonic
1007377554 6:41467077-41467099 ATGATTAAAGGGTTTCATTACGG - Intergenic
1009590404 6:65662353-65662375 ATGATCACCAGGTTACATTAAGG + Intronic
1010759306 6:79704094-79704116 AAGTTGAACATGTTTTATTATGG + Intergenic
1012798797 6:103798690-103798712 ATGAATAACATGTTTGCTTATGG + Intergenic
1012934740 6:105355042-105355064 AACATGAACAGGTCTGAGTAAGG + Intronic
1012997810 6:105991278-105991300 TTTATATACAGGTTTGATTAGGG - Intergenic
1016556450 6:145343865-145343887 AGGATGAAGAGGTTTCCTTAGGG - Intergenic
1017476815 6:154803547-154803569 TTGATGGATAGGTTTGATTTTGG + Exonic
1018321897 6:162619826-162619848 ATGATGGACATCTTTGATAAAGG + Intronic
1020741964 7:12031474-12031496 AAGTTGAACATGTTTTATTATGG + Intergenic
1020846303 7:13288677-13288699 ATGTTGAAATGGTTTAATTATGG - Intergenic
1021741837 7:23694531-23694553 ATGATGATCATGTTTGATGACGG + Intronic
1024995136 7:55268453-55268475 ATGCTGGTCAGGTTGGATTAGGG + Intergenic
1028890674 7:95985104-95985126 TTGCTGAACAGCTTTGACTATGG + Intronic
1028931373 7:96416129-96416151 GTGATAAGCAGGTTGGATTAGGG + Intergenic
1028982766 7:96984843-96984865 TTTATGAAGAGGTTTGATTGTGG - Intergenic
1032630129 7:133641835-133641857 ATGCTGAACAGGTTCGATAGAGG + Intronic
1040375964 8:46824799-46824821 ATGATGATCAAGTTTCTTTAGGG + Intergenic
1040524182 8:48204454-48204476 GTGATGCAGAGTTTTGATTATGG + Intergenic
1040920122 8:52606864-52606886 ATGCTTAACACGTTTGATTTTGG + Intergenic
1046052385 8:109039219-109039241 ATGTTGAAAAGGTTAGATCAAGG - Intergenic
1046304256 8:112342245-112342267 ATGATCACCAGATTTTATTAAGG - Intronic
1048200514 8:132370368-132370390 AGCAGGAACAGGTATGATTAAGG + Intronic
1049302433 8:141878792-141878814 ATGATGAACTGGCTTGACTGAGG + Intergenic
1051431035 9:16980791-16980813 CTGATGGACAGGTTAGATGAGGG - Intergenic
1052211472 9:25909275-25909297 ATGATGAGAAGGTTTGAGTGGGG - Intergenic
1055835435 9:80434995-80435017 AGGATGAACAGGGTTTAGTAAGG + Intergenic
1059811919 9:117864742-117864764 ATAGTGACCAGGATTGATTATGG + Intergenic
1194618035 X:96131869-96131891 TTGATCACCAGGTTTGATTCTGG + Intergenic
1194837611 X:98700027-98700049 ATGATGAACACATTTCACTATGG + Intergenic
1194918808 X:99738014-99738036 ATCATGCAAAGGTTTGACTAAGG - Intergenic
1195323061 X:103736574-103736596 ATGATGAACTTGTTTGACTTTGG - Intergenic
1195464675 X:105167402-105167424 ATGATAAACAGGTCTGAAGAAGG - Intronic
1195648192 X:107256815-107256837 ATGTTGAACAGGTTGTATTTGGG - Intergenic
1198272168 X:135065266-135065288 GTGTTGTACAGGTTTGAGTAGGG - Intergenic
1199951661 X:152712067-152712089 ATGATAAAAAAGTTTTATTAGGG - Intergenic
1199958022 X:152756381-152756403 ATGATAAAAAAGTTTTATTAGGG + Intergenic