ID: 1154939112

View in Genome Browser
Species Human (GRCh38)
Location 18:21093279-21093301
Sequence GCAAATGATGTGACTGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 157}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154939112_1154939115 -10 Left 1154939112 18:21093279-21093301 CCAGCTGCAGTCACATCATTTGC 0: 1
1: 0
2: 0
3: 10
4: 157
Right 1154939115 18:21093292-21093314 CATCATTTGCAAAACCTTTGGGG 0: 1
1: 0
2: 2
3: 16
4: 212
1154939112_1154939119 11 Left 1154939112 18:21093279-21093301 CCAGCTGCAGTCACATCATTTGC 0: 1
1: 0
2: 0
3: 10
4: 157
Right 1154939119 18:21093313-21093335 GGCCAGGCCAAATAAGCACAGGG 0: 1
1: 0
2: 0
3: 8
4: 145
1154939112_1154939118 10 Left 1154939112 18:21093279-21093301 CCAGCTGCAGTCACATCATTTGC 0: 1
1: 0
2: 0
3: 10
4: 157
Right 1154939118 18:21093312-21093334 GGGCCAGGCCAAATAAGCACAGG 0: 1
1: 0
2: 1
3: 14
4: 101
1154939112_1154939116 -5 Left 1154939112 18:21093279-21093301 CCAGCTGCAGTCACATCATTTGC 0: 1
1: 0
2: 0
3: 10
4: 157
Right 1154939116 18:21093297-21093319 TTTGCAAAACCTTTGGGGCCAGG 0: 1
1: 0
2: 0
3: 20
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154939112 Original CRISPR GCAAATGATGTGACTGCAGC TGG (reversed) Intronic
900921390 1:5673302-5673324 GCATCTTATGTGACTGGAGCAGG - Intergenic
900937509 1:5775838-5775860 ACAAAGGAGGTGACTGCAGGAGG - Intergenic
901786553 1:11628780-11628802 GCAAAAGATGTCTCTGCTGCTGG - Intergenic
902516542 1:16992544-16992566 CCAAATGCTGAGTCTGCAGCCGG + Exonic
903780791 1:25818965-25818987 GCAAATTATGTGACTGGTCCTGG - Intronic
903791370 1:25895481-25895503 GCAAATGCTGGGCCTCCAGCAGG + Intronic
904043065 1:27595145-27595167 GCAAATGTTGTGGCTACAGAGGG + Intronic
907497417 1:54854066-54854088 GCCCATGAAGTGCCTGCAGCAGG - Exonic
914719931 1:150281605-150281627 ACAAATGAAGGGACTGAAGCTGG + Intergenic
916482578 1:165228304-165228326 GGAAATGATGTAACTGCTGCAGG - Intronic
920201820 1:204264291-204264313 GTTAAAGATGTGCCTGCAGCTGG - Intronic
920267412 1:204734426-204734448 GGAAGTGGTGTGACTGGAGCAGG + Intergenic
920424298 1:205861318-205861340 GAAAAGGCTGTGACTGCAGCAGG + Intergenic
921794784 1:219329806-219329828 TCAAAGGCTGTGACTGCTGCAGG + Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
922458569 1:225797039-225797061 GAAAAGGCTGTGACTGCAGCGGG - Intergenic
1063962414 10:11318064-11318086 GGAAATCAAGTGCCTGCAGCTGG + Intronic
1066259851 10:33719033-33719055 GTAAATGATTTGACCGAAGCAGG + Intergenic
1067051150 10:43022010-43022032 GCAAGGGGTGTGAGTGCAGCAGG - Intergenic
1070743227 10:78916309-78916331 GCAAATGCTGTGACTCTCGCTGG - Intergenic
1073593401 10:104777453-104777475 GCAAAGACTGGGACTGCAGCAGG + Intronic
1073623444 10:105072760-105072782 CCAGATGATGTGTCTACAGCAGG + Intronic
1073948253 10:108777343-108777365 GTAAATAATGTAACTGCACCAGG - Intergenic
1074817007 10:117149909-117149931 GTAAATTATATGACTGCAGTTGG + Intergenic
1076124104 10:127961248-127961270 GGAAATAATTAGACTGCAGCTGG - Intronic
1077253407 11:1570696-1570718 GCAGATCATGTGACCCCAGCTGG - Intronic
1084775360 11:71371169-71371191 GCAATTGACCTGAATGCAGCAGG - Intergenic
1085716245 11:78876105-78876127 ACAAGTTATTTGACTGCAGCAGG + Intronic
1086073455 11:82824468-82824490 AAAAATGATGTAATTGCAGCTGG - Exonic
1086562121 11:88179629-88179651 GCAAATAATGTGACTTCACAGGG - Intergenic
1086909434 11:92455352-92455374 ATTAATGAAGTGACTGCAGCAGG - Intronic
1090845762 11:130528488-130528510 GCGAGTGAAGTGGCTGCAGCAGG + Intergenic
1091491717 12:938190-938212 GCACATGATGTGACTGTAATTGG - Intronic
1092006113 12:5071769-5071791 GTAAATGAGGTGACTGAAACTGG + Intergenic
1096870881 12:54591330-54591352 GCCCAGGCTGTGACTGCAGCAGG - Intergenic
1096887264 12:54730570-54730592 GAAAATAATGGGACTGCTGCTGG + Intergenic
1102886512 12:116526009-116526031 GCAAATGAGGTGGCTGGAGTTGG + Intergenic
1105817596 13:24051278-24051300 GGACATGCTGTGCCTGCAGCCGG + Intronic
1106823018 13:33487595-33487617 TCTAATGATGTGAGTGCACCGGG - Intergenic
1106971518 13:35146766-35146788 GCAAACAATGAGACAGCAGCAGG - Intronic
1108573630 13:51772693-51772715 GGCAATAGTGTGACTGCAGCTGG - Intronic
1117026014 14:51620831-51620853 ACCAATGATATGTCTGCAGCAGG - Intronic
1119335978 14:73834047-73834069 GCAGGTGATGTGACTGCCCCTGG - Intergenic
1122643154 14:103173653-103173675 GAAAAGGCTGTAACTGCAGCGGG + Intergenic
1122676313 14:103417120-103417142 GCAAATGCCATGCCTGCAGCTGG - Intronic
1126158715 15:45588615-45588637 GACAGTGATGTGACAGCAGCGGG - Intronic
1126523602 15:49624190-49624212 AGAAATGCTGTGACTCCAGCAGG - Intronic
1128352918 15:66903391-66903413 CCAAAGGGTGTGACAGCAGCTGG + Intergenic
1129373713 15:75114374-75114396 GCACATCGTGTGACTGCAGATGG - Intronic
1136408192 16:30061502-30061524 GCAAGTGATGGGAATGGAGCTGG - Intronic
1136650330 16:31663771-31663793 GAAAAGGCTGTAACTGCAGCAGG + Intergenic
1138943890 16:61823824-61823846 GGAAATAATTTCACTGCAGCTGG - Intronic
1140939681 16:79709638-79709660 GCAAATGAAGTGTCTTCTGCAGG - Intergenic
1141072988 16:80975046-80975068 GCCCCTGCTGTGACTGCAGCTGG + Exonic
1141351553 16:83302922-83302944 GCAACTGTAGTGACTGCACCTGG - Intronic
1141850605 16:86642733-86642755 GCCAATAATGTGCCTCCAGCAGG - Intergenic
1143615225 17:8045605-8045627 GCAGCAGATGTGAGTGCAGCAGG - Exonic
1144346505 17:14354473-14354495 AGAAATGATGTGGCTGGAGCAGG - Intergenic
1145370501 17:22303003-22303025 GCCATTGCTGTGGCTGCAGCAGG + Intergenic
1151861368 17:76765229-76765251 GCAAATGGCGTGACTACAACAGG - Intronic
1154006208 18:10529451-10529473 GCAAAAAATGTTACTGTAGCTGG + Intronic
1154939112 18:21093279-21093301 GCAAATGATGTGACTGCAGCTGG - Intronic
1155926166 18:31657893-31657915 CCACATGATTTGAGTGCAGCAGG - Intronic
1157351668 18:46893500-46893522 GCAAAGGATGTTAATGCAACTGG + Intronic
1159358460 18:67368436-67368458 AAAAATGATGTGACTGCATAGGG + Intergenic
1162693647 19:12454228-12454250 GAAAAGGCTGTAACTGCAGCAGG + Intronic
1163923648 19:20318286-20318308 GAAAAGTCTGTGACTGCAGCAGG - Intergenic
1167086546 19:47313652-47313674 GCAAATGGTGTGAATCCAGGAGG + Intronic
1168652479 19:58100485-58100507 GCTAATGAGGTGACTCCAGTGGG - Intronic
925323150 2:2992689-2992711 GGAAATGCTGTGACACCAGCAGG + Intergenic
928319236 2:30269979-30270001 GCAAATGATTCCACTTCAGCAGG + Intronic
928755767 2:34524138-34524160 GGCAATGATGTGAATGCATCCGG + Intergenic
930021952 2:47007007-47007029 GCTAATAATGTGACTGCATGTGG + Intronic
931242250 2:60463535-60463557 GGAAATAATGTGACTTAAGCAGG - Intronic
932840586 2:75078610-75078632 ACAAATGATGTGACTGGAGTAGG - Intronic
933009855 2:77046870-77046892 GCAAATGAAGTGACTTTGGCTGG + Intronic
935337582 2:102031403-102031425 GAAAAGGAGCTGACTGCAGCCGG + Intergenic
937010967 2:118562388-118562410 TCAAGTGATGTGTCTTCAGCAGG - Intergenic
939735620 2:145840904-145840926 TCAAATGAAGTGCCTGCATCTGG - Intergenic
941557825 2:167005331-167005353 GCCAATGAAGTCACTGCAGGTGG + Intronic
942404714 2:175642024-175642046 GCACTTCATGTGACTGAAGCAGG + Intergenic
945054884 2:205859781-205859803 GCAAATGCTGTGTCAGGAGCTGG - Intergenic
945699057 2:213148818-213148840 GCAAATGATCTGATTCCTGCTGG + Intronic
1168989962 20:2086648-2086670 TGAAATGATTTGACTACAGCTGG + Intergenic
1169622650 20:7525172-7525194 ACAAATGATGTCAAAGCAGCAGG - Intergenic
1170082115 20:12488033-12488055 GCAAGAGATGTGACTGCAGTTGG - Intergenic
1170725288 20:18920667-18920689 GCACATCATATGACTGGAGCAGG - Intergenic
1171055075 20:21898630-21898652 CCCAATGCTCTGACTGCAGCTGG + Intergenic
1172915513 20:38440570-38440592 GCAAAGGATTGGACTGTAGCTGG + Intergenic
1173000309 20:39100982-39101004 GGAAGTGCTGTGGCTGCAGCAGG + Intergenic
1173225178 20:41158290-41158312 GCAAATGCTGGCACTGCATCTGG + Intronic
1175963740 20:62649780-62649802 GCAAATGAGGAGTCTGCAGATGG - Intronic
1178111068 21:29370697-29370719 GCAAAAGTTGAGACTGGAGCCGG - Intronic
1179607244 21:42524853-42524875 GCTAATGAGGTGACTGTGGCGGG + Intronic
1179818004 21:43920476-43920498 GCTAATGAGGTGACTGTGGCTGG + Intronic
1181984558 22:26790665-26790687 TCAAAAGAGGTGACTGCAGCAGG + Intergenic
1182238431 22:28895381-28895403 GAAAATGCTGTGACTCCGGCCGG + Intronic
1182971990 22:34587858-34587880 GAAACTGTTGTGAGTGCAGCTGG - Intergenic
950016440 3:9757795-9757817 GCACATGAGGAAACTGCAGCTGG - Exonic
951641774 3:24844497-24844519 GCATACGATGTGACTGCAGTGGG + Intergenic
956287910 3:67629737-67629759 GCTAATGAGGTGACTGCTGGTGG - Intronic
958945639 3:100358927-100358949 GGAAATGATGTGTGTGCTGCAGG + Intergenic
961799309 3:129432760-129432782 GCAAATGATATGGGTGCTGCAGG - Intronic
961968939 3:130938542-130938564 GCAAATGATCTGATTCCAACTGG - Intronic
962050829 3:131813800-131813822 TCAAATACTGTGACAGCAGCAGG - Intronic
965429247 3:168566404-168566426 GGAAATAATCTGACTGCAGAAGG - Intergenic
969948422 4:10808146-10808168 GGACAGGACGTGACTGCAGCTGG + Intergenic
970542580 4:17094655-17094677 GCAAATGATCTGATTTCTGCTGG - Intergenic
971519171 4:27527795-27527817 GAATACGATGTGACTGTAGCAGG + Intergenic
972497991 4:39651800-39651822 GCAAATGGTCTCTCTGCAGCTGG + Intergenic
976829604 4:89299551-89299573 AAAAATGAGGTGACTGCATCAGG - Intronic
977359280 4:95982318-95982340 CCAAATGCTGTGAATGCTGCTGG - Intergenic
980187559 4:129481336-129481358 GCAAGTGATATGACTGCATGGGG + Intergenic
982128217 4:152202911-152202933 GCAAAATATGTGACTGGACCAGG + Intergenic
984083163 4:175275108-175275130 GTAAATGATGTAAATGCTGCTGG + Intergenic
985932985 5:3073512-3073534 GCTAATGATGTGACTCCTGGTGG - Intergenic
987397866 5:17442894-17442916 GCACCTCATGTGACTGAAGCAGG + Intergenic
987797875 5:22653572-22653594 GCAAAGGATTTGCATGCAGCAGG - Intronic
988609206 5:32710052-32710074 GCAAATGACTTGGCTGCAGTAGG + Intronic
991398812 5:66232926-66232948 CCAAATGAAGTGTCTGCAGCTGG + Intergenic
991584666 5:68189754-68189776 GCTAACGATGTGACAGCAGAAGG + Intergenic
996403658 5:123087481-123087503 GCAAATGACGGGACCGCCGCCGG + Intergenic
1000133224 5:158319938-158319960 GCAAATGAGGGGACTTCATCTGG + Intergenic
1000604426 5:163313026-163313048 CCAAATGATGGTACTGTAGCAGG + Intergenic
1002051268 5:176572978-176573000 GTCAAGGAAGTGACTGCAGCGGG + Intronic
1004116275 6:12771020-12771042 GCAAAGGATGAGACTGGAGAGGG + Intronic
1004760855 6:18664452-18664474 GGAAATGATGAGATTCCAGCTGG - Intergenic
1006012746 6:31056283-31056305 GAAAATGATGTAACTGCAGATGG + Intergenic
1012853116 6:104470476-104470498 GCAAATAATGGGAGTGTAGCAGG - Intergenic
1014294596 6:119603403-119603425 GCAATTGATGTGATTGCTGCAGG + Intergenic
1014596192 6:123342863-123342885 GCAAATCATATGTCTGAAGCAGG + Intronic
1016211575 6:141541578-141541600 GCATTTAATGTGACTGCATCTGG - Intergenic
1018857318 6:167683977-167683999 GCCAATGATGGGACTTAAGCTGG - Intergenic
1019147920 6:169986689-169986711 GCAGAGGCTGTGACCGCAGCCGG + Intergenic
1020020019 7:4860304-4860326 GCACATGATGAGGCAGCAGCTGG + Exonic
1020226498 7:6284564-6284586 GAGAGTGGTGTGACTGCAGCAGG + Intergenic
1020320560 7:6936152-6936174 CCAGATGTTGTCACTGCAGCAGG - Intergenic
1020725980 7:11815287-11815309 GCAAGTGATGGACCTGCAGCAGG + Intronic
1023028201 7:36070942-36070964 GCACATGATGTAACTGCTGAAGG - Intergenic
1023352607 7:39335335-39335357 ACAAATGATTTGCCTGCAGTAGG + Intronic
1023481617 7:40641154-40641176 GGAAATGAAGGGACTGCAGAGGG - Intronic
1023772343 7:43569480-43569502 GTAAAGGATGTGACTTCAGGGGG - Intergenic
1024778484 7:52816859-52816881 CCGAATTATGTGACTGCTGCTGG - Intergenic
1024908387 7:54415977-54415999 GCAAATCATGTGACTGATGAGGG + Intergenic
1028593650 7:92525456-92525478 GAACTTGATGTGATTGCAGCAGG - Intronic
1032708532 7:134442906-134442928 GCAGATGATGGTTCTGCAGCTGG + Intronic
1034281905 7:149860479-149860501 ACAAATGCTGGAACTGCAGCAGG - Exonic
1034448891 7:151127012-151127034 GCAATTGATGTCACAGCTGCTGG + Intronic
1036384706 8:8269110-8269132 TAAGATGATTTGACTGCAGCAGG + Intergenic
1036501320 8:9317078-9317100 GCACATCATGTGGCTGCTGCTGG + Intergenic
1040986043 8:53295590-53295612 GCTAATGAAGTGACTCCAGATGG - Intergenic
1041671470 8:60495836-60495858 GAAAAGGCTGTAACTGCAGCAGG + Intergenic
1044697919 8:94941772-94941794 GGAAGTTATGTGACTTCAGCTGG + Intronic
1046618438 8:116502226-116502248 GCTAATCAAGTGACAGCAGCTGG + Intergenic
1048094328 8:131274945-131274967 ACAAATGATGAGACTCCAGACGG + Intergenic
1050433607 9:5586695-5586717 GCAAAGTATGTGGCTGCATCTGG + Intergenic
1052589956 9:30479282-30479304 GCAAATTATCTAACTGGAGCCGG + Intergenic
1053505920 9:38643099-38643121 GGTGATGATGTGGCTGCAGCCGG + Intergenic
1060359352 9:122940742-122940764 GCCAACTACGTGACTGCAGCCGG - Intergenic
1185802133 X:3020835-3020857 GCAAATAAAATAACTGCAGCTGG - Intronic
1185932190 X:4215660-4215682 GCAAATGAGGTGAATGCCACAGG + Intergenic
1186092482 X:6064639-6064661 GCAAATGAGGCAAGTGCAGCGGG + Intronic
1186963771 X:14765199-14765221 TCAGATGATTTGACTGAAGCAGG - Intergenic
1188359111 X:29230804-29230826 GCAATACATGTGACTGAAGCTGG + Intronic
1188697958 X:33220139-33220161 GGAAATTATGTGACACCAGCTGG - Intronic
1189320916 X:40086700-40086722 GCAAATAATGTGACAGCTGTTGG - Intronic
1199096041 X:143740411-143740433 GCAAATCATGTCACTGCACTTGG + Intergenic
1201402345 Y:13616947-13616969 GAAAAGGCTGTAACTGCAGCAGG - Intergenic