ID: 1154942034

View in Genome Browser
Species Human (GRCh38)
Location 18:21123564-21123586
Sequence ATTTATCTCTAGAACTATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154942034_1154942039 27 Left 1154942034 18:21123564-21123586 CCCTCATAGTTCTAGAGATAAAT No data
Right 1154942039 18:21123614-21123636 TACTTTTGAACGGTTTATTTAGG No data
1154942034_1154942038 17 Left 1154942034 18:21123564-21123586 CCCTCATAGTTCTAGAGATAAAT No data
Right 1154942038 18:21123604-21123626 AATGTACTGCTACTTTTGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154942034 Original CRISPR ATTTATCTCTAGAACTATGA GGG (reversed) Intergenic
No off target data available for this crispr