ID: 1154944028

View in Genome Browser
Species Human (GRCh38)
Location 18:21143159-21143181
Sequence AGATGTACCATGTATATTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154944028_1154944029 5 Left 1154944028 18:21143159-21143181 CCACGAATATACATGGTACATCT No data
Right 1154944029 18:21143187-21143209 TTTAAAGACTAAATTTGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154944028 Original CRISPR AGATGTACCATGTATATTCG TGG (reversed) Intergenic
No off target data available for this crispr