ID: 1154945482

View in Genome Browser
Species Human (GRCh38)
Location 18:21157846-21157868
Sequence CAGAACCCAGCAGTGCTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154945482_1154945485 6 Left 1154945482 18:21157846-21157868 CCCAACAGCACTGCTGGGTTCTG No data
Right 1154945485 18:21157875-21157897 TCATGATGCTACAGCCCTCTCGG No data
1154945482_1154945486 9 Left 1154945482 18:21157846-21157868 CCCAACAGCACTGCTGGGTTCTG No data
Right 1154945486 18:21157878-21157900 TGATGCTACAGCCCTCTCGGTGG No data
1154945482_1154945487 15 Left 1154945482 18:21157846-21157868 CCCAACAGCACTGCTGGGTTCTG No data
Right 1154945487 18:21157884-21157906 TACAGCCCTCTCGGTGGACATGG No data
1154945482_1154945488 18 Left 1154945482 18:21157846-21157868 CCCAACAGCACTGCTGGGTTCTG No data
Right 1154945488 18:21157887-21157909 AGCCCTCTCGGTGGACATGGAGG No data
1154945482_1154945489 19 Left 1154945482 18:21157846-21157868 CCCAACAGCACTGCTGGGTTCTG No data
Right 1154945489 18:21157888-21157910 GCCCTCTCGGTGGACATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154945482 Original CRISPR CAGAACCCAGCAGTGCTGTT GGG (reversed) Intergenic
No off target data available for this crispr