ID: 1154949799

View in Genome Browser
Species Human (GRCh38)
Location 18:21198639-21198661
Sequence GCATCTGTTAAGACCCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154949796_1154949799 29 Left 1154949796 18:21198587-21198609 CCAACATAGACTGAGTGCTAAAG No data
Right 1154949799 18:21198639-21198661 GCATCTGTTAAGACCCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154949799 Original CRISPR GCATCTGTTAAGACCCAGAG AGG Intergenic
No off target data available for this crispr