ID: 1154950141

View in Genome Browser
Species Human (GRCh38)
Location 18:21201976-21201998
Sequence CCATCTAATACTTTGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154950141_1154950146 30 Left 1154950141 18:21201976-21201998 CCTGCTTCCAAAGTATTAGATGG No data
Right 1154950146 18:21202029-21202051 AGAATTAATATTAATAATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154950141 Original CRISPR CCATCTAATACTTTGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr