ID: 1154954404

View in Genome Browser
Species Human (GRCh38)
Location 18:21241479-21241501
Sequence CCAGGGCAGCCGCGTCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154954404_1154954412 2 Left 1154954404 18:21241479-21241501 CCAGCTGGACGCGGCTGCCCTGG No data
Right 1154954412 18:21241504-21241526 TGGAGCCGTCCCCGTGGTCCCGG No data
1154954404_1154954425 29 Left 1154954404 18:21241479-21241501 CCAGCTGGACGCGGCTGCCCTGG No data
Right 1154954425 18:21241531-21241553 CTACCGACGAGCCGGGGCCCGGG No data
1154954404_1154954424 28 Left 1154954404 18:21241479-21241501 CCAGCTGGACGCGGCTGCCCTGG No data
Right 1154954424 18:21241530-21241552 GCTACCGACGAGCCGGGGCCCGG No data
1154954404_1154954422 22 Left 1154954404 18:21241479-21241501 CCAGCTGGACGCGGCTGCCCTGG No data
Right 1154954422 18:21241524-21241546 CGGGAGGCTACCGACGAGCCGGG No data
1154954404_1154954413 3 Left 1154954404 18:21241479-21241501 CCAGCTGGACGCGGCTGCCCTGG No data
Right 1154954413 18:21241505-21241527 GGAGCCGTCCCCGTGGTCCCGGG No data
1154954404_1154954421 21 Left 1154954404 18:21241479-21241501 CCAGCTGGACGCGGCTGCCCTGG No data
Right 1154954421 18:21241523-21241545 CCGGGAGGCTACCGACGAGCCGG No data
1154954404_1154954411 -4 Left 1154954404 18:21241479-21241501 CCAGCTGGACGCGGCTGCCCTGG No data
Right 1154954411 18:21241498-21241520 CTGGGGTGGAGCCGTCCCCGTGG No data
1154954404_1154954426 30 Left 1154954404 18:21241479-21241501 CCAGCTGGACGCGGCTGCCCTGG No data
Right 1154954426 18:21241532-21241554 TACCGACGAGCCGGGGCCCGGGG No data
1154954404_1154954423 23 Left 1154954404 18:21241479-21241501 CCAGCTGGACGCGGCTGCCCTGG No data
Right 1154954423 18:21241525-21241547 GGGAGGCTACCGACGAGCCGGGG No data
1154954404_1154954414 6 Left 1154954404 18:21241479-21241501 CCAGCTGGACGCGGCTGCCCTGG No data
Right 1154954414 18:21241508-21241530 GCCGTCCCCGTGGTCCCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154954404 Original CRISPR CCAGGGCAGCCGCGTCCAGC TGG (reversed) Intergenic
No off target data available for this crispr