ID: 1154954409

View in Genome Browser
Species Human (GRCh38)
Location 18:21241496-21241518
Sequence ACGGGGACGGCTCCACCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154954409_1154954428 17 Left 1154954409 18:21241496-21241518 CCCTGGGGTGGAGCCGTCCCCGT No data
Right 1154954428 18:21241536-21241558 GACGAGCCGGGGCCCGGGGCCGG No data
1154954409_1154954430 21 Left 1154954409 18:21241496-21241518 CCCTGGGGTGGAGCCGTCCCCGT No data
Right 1154954430 18:21241540-21241562 AGCCGGGGCCCGGGGCCGGAGGG No data
1154954409_1154954424 11 Left 1154954409 18:21241496-21241518 CCCTGGGGTGGAGCCGTCCCCGT No data
Right 1154954424 18:21241530-21241552 GCTACCGACGAGCCGGGGCCCGG No data
1154954409_1154954421 4 Left 1154954409 18:21241496-21241518 CCCTGGGGTGGAGCCGTCCCCGT No data
Right 1154954421 18:21241523-21241545 CCGGGAGGCTACCGACGAGCCGG No data
1154954409_1154954423 6 Left 1154954409 18:21241496-21241518 CCCTGGGGTGGAGCCGTCCCCGT No data
Right 1154954423 18:21241525-21241547 GGGAGGCTACCGACGAGCCGGGG No data
1154954409_1154954426 13 Left 1154954409 18:21241496-21241518 CCCTGGGGTGGAGCCGTCCCCGT No data
Right 1154954426 18:21241532-21241554 TACCGACGAGCCGGGGCCCGGGG No data
1154954409_1154954425 12 Left 1154954409 18:21241496-21241518 CCCTGGGGTGGAGCCGTCCCCGT No data
Right 1154954425 18:21241531-21241553 CTACCGACGAGCCGGGGCCCGGG No data
1154954409_1154954429 20 Left 1154954409 18:21241496-21241518 CCCTGGGGTGGAGCCGTCCCCGT No data
Right 1154954429 18:21241539-21241561 GAGCCGGGGCCCGGGGCCGGAGG No data
1154954409_1154954422 5 Left 1154954409 18:21241496-21241518 CCCTGGGGTGGAGCCGTCCCCGT No data
Right 1154954422 18:21241524-21241546 CGGGAGGCTACCGACGAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154954409 Original CRISPR ACGGGGACGGCTCCACCCCA GGG (reversed) Intergenic
No off target data available for this crispr