ID: 1154954410

View in Genome Browser
Species Human (GRCh38)
Location 18:21241497-21241519
Sequence CACGGGGACGGCTCCACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154954410_1154954430 20 Left 1154954410 18:21241497-21241519 CCTGGGGTGGAGCCGTCCCCGTG No data
Right 1154954430 18:21241540-21241562 AGCCGGGGCCCGGGGCCGGAGGG No data
1154954410_1154954425 11 Left 1154954410 18:21241497-21241519 CCTGGGGTGGAGCCGTCCCCGTG No data
Right 1154954425 18:21241531-21241553 CTACCGACGAGCCGGGGCCCGGG No data
1154954410_1154954421 3 Left 1154954410 18:21241497-21241519 CCTGGGGTGGAGCCGTCCCCGTG No data
Right 1154954421 18:21241523-21241545 CCGGGAGGCTACCGACGAGCCGG No data
1154954410_1154954423 5 Left 1154954410 18:21241497-21241519 CCTGGGGTGGAGCCGTCCCCGTG No data
Right 1154954423 18:21241525-21241547 GGGAGGCTACCGACGAGCCGGGG No data
1154954410_1154954428 16 Left 1154954410 18:21241497-21241519 CCTGGGGTGGAGCCGTCCCCGTG No data
Right 1154954428 18:21241536-21241558 GACGAGCCGGGGCCCGGGGCCGG No data
1154954410_1154954426 12 Left 1154954410 18:21241497-21241519 CCTGGGGTGGAGCCGTCCCCGTG No data
Right 1154954426 18:21241532-21241554 TACCGACGAGCCGGGGCCCGGGG No data
1154954410_1154954424 10 Left 1154954410 18:21241497-21241519 CCTGGGGTGGAGCCGTCCCCGTG No data
Right 1154954424 18:21241530-21241552 GCTACCGACGAGCCGGGGCCCGG No data
1154954410_1154954422 4 Left 1154954410 18:21241497-21241519 CCTGGGGTGGAGCCGTCCCCGTG No data
Right 1154954422 18:21241524-21241546 CGGGAGGCTACCGACGAGCCGGG No data
1154954410_1154954429 19 Left 1154954410 18:21241497-21241519 CCTGGGGTGGAGCCGTCCCCGTG No data
Right 1154954429 18:21241539-21241561 GAGCCGGGGCCCGGGGCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154954410 Original CRISPR CACGGGGACGGCTCCACCCC AGG (reversed) Intergenic
No off target data available for this crispr