ID: 1154954415

View in Genome Browser
Species Human (GRCh38)
Location 18:21241509-21241531
Sequence GCCTCCCGGGACCACGGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154954415_1154954429 7 Left 1154954415 18:21241509-21241531 CCGTCCCCGTGGTCCCGGGAGGC No data
Right 1154954429 18:21241539-21241561 GAGCCGGGGCCCGGGGCCGGAGG No data
1154954415_1154954421 -9 Left 1154954415 18:21241509-21241531 CCGTCCCCGTGGTCCCGGGAGGC No data
Right 1154954421 18:21241523-21241545 CCGGGAGGCTACCGACGAGCCGG No data
1154954415_1154954422 -8 Left 1154954415 18:21241509-21241531 CCGTCCCCGTGGTCCCGGGAGGC No data
Right 1154954422 18:21241524-21241546 CGGGAGGCTACCGACGAGCCGGG No data
1154954415_1154954423 -7 Left 1154954415 18:21241509-21241531 CCGTCCCCGTGGTCCCGGGAGGC No data
Right 1154954423 18:21241525-21241547 GGGAGGCTACCGACGAGCCGGGG No data
1154954415_1154954428 4 Left 1154954415 18:21241509-21241531 CCGTCCCCGTGGTCCCGGGAGGC No data
Right 1154954428 18:21241536-21241558 GACGAGCCGGGGCCCGGGGCCGG No data
1154954415_1154954435 22 Left 1154954415 18:21241509-21241531 CCGTCCCCGTGGTCCCGGGAGGC No data
Right 1154954435 18:21241554-21241576 GCCGGAGGGCGTGCTCCTCCGGG No data
1154954415_1154954437 25 Left 1154954415 18:21241509-21241531 CCGTCCCCGTGGTCCCGGGAGGC No data
Right 1154954437 18:21241557-21241579 GGAGGGCGTGCTCCTCCGGGAGG No data
1154954415_1154954426 0 Left 1154954415 18:21241509-21241531 CCGTCCCCGTGGTCCCGGGAGGC No data
Right 1154954426 18:21241532-21241554 TACCGACGAGCCGGGGCCCGGGG No data
1154954415_1154954424 -2 Left 1154954415 18:21241509-21241531 CCGTCCCCGTGGTCCCGGGAGGC No data
Right 1154954424 18:21241530-21241552 GCTACCGACGAGCCGGGGCCCGG No data
1154954415_1154954430 8 Left 1154954415 18:21241509-21241531 CCGTCCCCGTGGTCCCGGGAGGC No data
Right 1154954430 18:21241540-21241562 AGCCGGGGCCCGGGGCCGGAGGG No data
1154954415_1154954425 -1 Left 1154954415 18:21241509-21241531 CCGTCCCCGTGGTCCCGGGAGGC No data
Right 1154954425 18:21241531-21241553 CTACCGACGAGCCGGGGCCCGGG No data
1154954415_1154954434 21 Left 1154954415 18:21241509-21241531 CCGTCCCCGTGGTCCCGGGAGGC No data
Right 1154954434 18:21241553-21241575 GGCCGGAGGGCGTGCTCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154954415 Original CRISPR GCCTCCCGGGACCACGGGGA CGG (reversed) Intergenic
No off target data available for this crispr