ID: 1154954418

View in Genome Browser
Species Human (GRCh38)
Location 18:21241515-21241537
Sequence TCGGTAGCCTCCCGGGACCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154954418_1154954437 19 Left 1154954418 18:21241515-21241537 CCGTGGTCCCGGGAGGCTACCGA No data
Right 1154954437 18:21241557-21241579 GGAGGGCGTGCTCCTCCGGGAGG No data
1154954418_1154954429 1 Left 1154954418 18:21241515-21241537 CCGTGGTCCCGGGAGGCTACCGA No data
Right 1154954429 18:21241539-21241561 GAGCCGGGGCCCGGGGCCGGAGG No data
1154954418_1154954426 -6 Left 1154954418 18:21241515-21241537 CCGTGGTCCCGGGAGGCTACCGA No data
Right 1154954426 18:21241532-21241554 TACCGACGAGCCGGGGCCCGGGG No data
1154954418_1154954428 -2 Left 1154954418 18:21241515-21241537 CCGTGGTCCCGGGAGGCTACCGA No data
Right 1154954428 18:21241536-21241558 GACGAGCCGGGGCCCGGGGCCGG No data
1154954418_1154954425 -7 Left 1154954418 18:21241515-21241537 CCGTGGTCCCGGGAGGCTACCGA No data
Right 1154954425 18:21241531-21241553 CTACCGACGAGCCGGGGCCCGGG No data
1154954418_1154954434 15 Left 1154954418 18:21241515-21241537 CCGTGGTCCCGGGAGGCTACCGA No data
Right 1154954434 18:21241553-21241575 GGCCGGAGGGCGTGCTCCTCCGG No data
1154954418_1154954424 -8 Left 1154954418 18:21241515-21241537 CCGTGGTCCCGGGAGGCTACCGA No data
Right 1154954424 18:21241530-21241552 GCTACCGACGAGCCGGGGCCCGG No data
1154954418_1154954430 2 Left 1154954418 18:21241515-21241537 CCGTGGTCCCGGGAGGCTACCGA No data
Right 1154954430 18:21241540-21241562 AGCCGGGGCCCGGGGCCGGAGGG No data
1154954418_1154954435 16 Left 1154954418 18:21241515-21241537 CCGTGGTCCCGGGAGGCTACCGA No data
Right 1154954435 18:21241554-21241576 GCCGGAGGGCGTGCTCCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154954418 Original CRISPR TCGGTAGCCTCCCGGGACCA CGG (reversed) Intergenic
No off target data available for this crispr