ID: 1154954422

View in Genome Browser
Species Human (GRCh38)
Location 18:21241524-21241546
Sequence CGGGAGGCTACCGACGAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154954404_1154954422 22 Left 1154954404 18:21241479-21241501 CCAGCTGGACGCGGCTGCCCTGG No data
Right 1154954422 18:21241524-21241546 CGGGAGGCTACCGACGAGCCGGG No data
1154954402_1154954422 29 Left 1154954402 18:21241472-21241494 CCCAGGGCCAGCTGGACGCGGCT No data
Right 1154954422 18:21241524-21241546 CGGGAGGCTACCGACGAGCCGGG No data
1154954415_1154954422 -8 Left 1154954415 18:21241509-21241531 CCGTCCCCGTGGTCCCGGGAGGC No data
Right 1154954422 18:21241524-21241546 CGGGAGGCTACCGACGAGCCGGG No data
1154954409_1154954422 5 Left 1154954409 18:21241496-21241518 CCCTGGGGTGGAGCCGTCCCCGT No data
Right 1154954422 18:21241524-21241546 CGGGAGGCTACCGACGAGCCGGG No data
1154954403_1154954422 28 Left 1154954403 18:21241473-21241495 CCAGGGCCAGCTGGACGCGGCTG No data
Right 1154954422 18:21241524-21241546 CGGGAGGCTACCGACGAGCCGGG No data
1154954410_1154954422 4 Left 1154954410 18:21241497-21241519 CCTGGGGTGGAGCCGTCCCCGTG No data
Right 1154954422 18:21241524-21241546 CGGGAGGCTACCGACGAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154954422 Original CRISPR CGGGAGGCTACCGACGAGCC GGG Intergenic
No off target data available for this crispr