ID: 1154954424

View in Genome Browser
Species Human (GRCh38)
Location 18:21241530-21241552
Sequence GCTACCGACGAGCCGGGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154954404_1154954424 28 Left 1154954404 18:21241479-21241501 CCAGCTGGACGCGGCTGCCCTGG No data
Right 1154954424 18:21241530-21241552 GCTACCGACGAGCCGGGGCCCGG No data
1154954410_1154954424 10 Left 1154954410 18:21241497-21241519 CCTGGGGTGGAGCCGTCCCCGTG No data
Right 1154954424 18:21241530-21241552 GCTACCGACGAGCCGGGGCCCGG No data
1154954409_1154954424 11 Left 1154954409 18:21241496-21241518 CCCTGGGGTGGAGCCGTCCCCGT No data
Right 1154954424 18:21241530-21241552 GCTACCGACGAGCCGGGGCCCGG No data
1154954417_1154954424 -7 Left 1154954417 18:21241514-21241536 CCCGTGGTCCCGGGAGGCTACCG No data
Right 1154954424 18:21241530-21241552 GCTACCGACGAGCCGGGGCCCGG No data
1154954415_1154954424 -2 Left 1154954415 18:21241509-21241531 CCGTCCCCGTGGTCCCGGGAGGC No data
Right 1154954424 18:21241530-21241552 GCTACCGACGAGCCGGGGCCCGG No data
1154954418_1154954424 -8 Left 1154954418 18:21241515-21241537 CCGTGGTCCCGGGAGGCTACCGA No data
Right 1154954424 18:21241530-21241552 GCTACCGACGAGCCGGGGCCCGG No data
1154954416_1154954424 -6 Left 1154954416 18:21241513-21241535 CCCCGTGGTCCCGGGAGGCTACC No data
Right 1154954424 18:21241530-21241552 GCTACCGACGAGCCGGGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154954424 Original CRISPR GCTACCGACGAGCCGGGGCC CGG Intergenic
No off target data available for this crispr