ID: 1154954426

View in Genome Browser
Species Human (GRCh38)
Location 18:21241532-21241554
Sequence TACCGACGAGCCGGGGCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154954415_1154954426 0 Left 1154954415 18:21241509-21241531 CCGTCCCCGTGGTCCCGGGAGGC No data
Right 1154954426 18:21241532-21241554 TACCGACGAGCCGGGGCCCGGGG No data
1154954418_1154954426 -6 Left 1154954418 18:21241515-21241537 CCGTGGTCCCGGGAGGCTACCGA No data
Right 1154954426 18:21241532-21241554 TACCGACGAGCCGGGGCCCGGGG No data
1154954410_1154954426 12 Left 1154954410 18:21241497-21241519 CCTGGGGTGGAGCCGTCCCCGTG No data
Right 1154954426 18:21241532-21241554 TACCGACGAGCCGGGGCCCGGGG No data
1154954404_1154954426 30 Left 1154954404 18:21241479-21241501 CCAGCTGGACGCGGCTGCCCTGG No data
Right 1154954426 18:21241532-21241554 TACCGACGAGCCGGGGCCCGGGG No data
1154954409_1154954426 13 Left 1154954409 18:21241496-21241518 CCCTGGGGTGGAGCCGTCCCCGT No data
Right 1154954426 18:21241532-21241554 TACCGACGAGCCGGGGCCCGGGG No data
1154954416_1154954426 -4 Left 1154954416 18:21241513-21241535 CCCCGTGGTCCCGGGAGGCTACC No data
Right 1154954426 18:21241532-21241554 TACCGACGAGCCGGGGCCCGGGG No data
1154954417_1154954426 -5 Left 1154954417 18:21241514-21241536 CCCGTGGTCCCGGGAGGCTACCG No data
Right 1154954426 18:21241532-21241554 TACCGACGAGCCGGGGCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154954426 Original CRISPR TACCGACGAGCCGGGGCCCG GGG Intergenic
No off target data available for this crispr